Abstract
Modern strains of Mycobacterium tuberculosis from the Americas are closely related to those from Europe, supporting the assumption that human tuberculosis was introduced post-contact1. This notion, however, is incompatible with archaeological evidence of pre-contact tuberculosis in the New World2. Comparative genomics of modern isolates suggests that M. tuberculosis attained its worldwide distribution following human dispersals out of Africa during the Pleistocene epoch3, although this has yet to be confirmed with ancient calibration points. Here we present three 1,000-year-old mycobacterial genomes from Peruvian human skeletons, revealing that a member of the M. tuberculosis complex caused human disease before contact. The ancient strains are distinct from known human-adapted forms and are most closely related to those adapted to seals and sea lions. Two independent dating approaches suggest a most recent common ancestor for the M. tuberculosis complex less than 6,000 years ago, which supports a Holocene dispersal of the disease. Our results implicate sea mammals as having played a role in transmitting the disease to humans across the ocean.
This is a preview of subscription content, access via your institution
Access options
Subscribe to this journal
Receive 52 print issues and online access
$199.00 per year
only $3.83 per issue
Buy this article
- Purchase on SpringerLink
- Instant access to the full article PDF.
USD 39.95
Prices may be subject to local taxes which are calculated during checkout



Similar content being viewed by others
Change history
23 October 2014
Minor changes were made to the author list, Fig. 3 and ED Figs 1 and 8.
References
Hershberg, R. et al. High functional diversity in Mycobacterium tuberculosis driven by genetic drift and human demography. PLoS Biol. 6, e311 (2008)
Roberts, C. A. & Buikstra, J. E. The Bioarchaeology of Tuberculosis. A Global View on a Reemerging Disease 187–213 (Univ. Press of Florida, 2003)
Comas, I. et al. Out-of-Africa migration and Neolithic coexpansion of Mycobacterium tuberculosis with modern humans. Nature Genet. 45, 1176–1182 (2013)
Wirth, T. et al. Origin, spread, and demography of the Mycobacterium tuberculosis complex. PLoS Pathogens 4, e1000160 (2008)
Cockburn, A. The Evolution and Eradication of Infectious Diseases (Johns Hopkins Press, 1963)
Brosch, R. et al. A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc. Natl Acad. Sci. USA 99, 3684–3689 (2002)
Gagneux, S. & Small, P. M. Global phylogeography of Mycobacterium tuberculosis and implications for tuberculosis product development. Lancet Infect. Dis. 7, 328–337 (2007)
Gagneux, S. et al. Variable host-pathogen compatibility in Mycobacterium tuberculosis. Proc. Natl Acad. Sci. USA 103, 2869–2873 (2006)
Comas, I. et al. Human T-cell epitopes of Mycobacterium tuberculosis are evolutionarily hyperconserved. Nature Genet. 42, 498–503 (2010)
Pepperell, C. S. et al. The role of selection in shaping diversity of natural M. tuberculosis populations. PLoS Pathogens 9, e1003543 (2013)
Shapiro, B. & Gilbert, M. P. T. No proof that typhoid fever caused the Plague of Athens (a reply to Papagrigorakis et al.). Int. J. Infect. Dis. 10, 334–340 (2006)
Bos, K. I. et al. A draft genome of Yersinia pestis from victims of the Black Death. Nature 478, 506–510 (2011)
Bouwman, A. et al. Genotype of a historic strain of Mycobacterium tuberculosis. Proc. Natl Acad. Sci. USA 109, 18511–18516 (2012)
Chan, J. Z.-M. et al. Metagenomic analysis of tuberculosis in a mummy. N. Engl. J. Med. 369, 289–290 (2013)
Briggs, A. W. et al. Patterns of damage in genomic DNA sequences from a Neandertal. Proc. Natl Acad. Sci. USA 104, 14616–14621 (2007)
Coscolla, M. et al. Novel Mycobacterium tuberculosis complex from a wild chimpanzee. Emerg. Infect. Dis. 19, 969–976 (2013)
Bastida, R. et al. Tuberculosis in a wild subantarctic fur seal from Argentina. J. Wildl. Dis. 35, 796–798 (1999)
Comas, I. et al. Whole-genome sequencing of rifampicin-resistant Mycobacterium tuberculosis strains identifies compensatory mutations in RNA polymerase genes. Nature Genet. 18, 106–110 (2012)
Botella, H. et al. Metallobiology of host-pathogen interactions: an intoxicating new insight. Trends Microbiol. 20, 106–112 (2012)
Bryant, J. M. et al. Inferring patient to patient transmission of Mycobacterium tuberculosis from whole genome sequencing data. BMC Infect. Dis. 13, 110 (2013)
Elias, S. A., Short, S. K., Nelson, C. H. & Birks, H. H. Life and times of the Bering land bridge. Nature 382, 60–63 (1996)
Patrucco, R. et al. Parasitological studies of coprolites of pre-Hispanic Peruvian populations. Curr. Anthropol. 24, 393–394 (1983)
Bastida, R. et al. La tuberculosis en grupos de cazadores recolectores de Patagonia y Tierra del Fuego: nuevas alternativas de contagio a través de la fauna silvestre. Rev. Arg. Antropol. Biol. 13, 83–95 (2011)
Salo, W. et al. Identification of Mycobacterium tuberculosis DNA in a pre-Columbian Peruvian mummy. Proc. Natl Acad. Sci. USA 91, 2091–2094 (1994)
Arriaza, R. T. et al. Pre-Columbian tuberculosis in northern Chile: molecular and skeletal evidence. Am. J. Phys. Anthropol. 98, 37–45 (1995)
Anawalt, P. R. Cultural contacts between Ecuador, west Mexico, and the American Southwest: clothing similarities. Lat. Am. Antiq. 3, 114–129 (1992)
Herring, D. A. & Sattenspiel, L. Social contexts, syndemics, and infectious disease in northern Aboriginal populations. Am. J. Hum. Biol. 19, 190–202 (2007)
Jurczynski, K. et al. Pinniped tuberculosis in Malayan tapirs (Tapirus indicus) and its transmission to other terrestrial mammals. J. Zoo Wildl. Med. 42, 222–227 (2011)
Berg, S. et al. The burden of mycobacterial disease in Ethiopian cattle: implications for public health. PLoS ONE 4, e5068 (2009)
Cui, Y. et al. Historical variations in mutation rate in an epidemic pathogen, Yersinia pestis. Proc. Natl Acad. Sci. USA 110, 577–582 (2012)
Drummond, A. J. & Rambaut, A. (2007). BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 7, 214
Acknowledgements
We thank the following people and institutions for assistance and/or permission for sampling: Museo Contisuyo, Centro Mallqui, S. Guillen, Instituto Nacional de Cultura, Peru, G. Cock, C. Gaither, M. Murphy, M. C. Lozada, S. Burgess, D. Blom, B. Owen, A. Oquiche Hernani, P. Palacios Filinich, S. Williams, B. Vargas, D. Rice, and H. Klaus, S. Pfieffer, the University of Toronto, the Upper Mississippi Valley Archaeological Research Foundation, L. Conrad, Indiana University, G. Milner, the Pennsylvania State University, the American Museum of Natural History, A. Stodder, B. Brier, I. Tattersall, K. Mowbray, the National Museum of Natural History (Smithsonian Institution), B. Billeck, the Smithsonian Institution, N. Tuross, L.-A. Pfister, Rochester Museum & Science Center, L. P. Saunders, C. Grivas, G. Housman, and M. Nieves-Colon. We thank H. Poinar for discussions about capture regions for M. tuberculosis screening. We thank B. Coombes and B. Krause-Kyora for providing modern tuberculosis for bait manufacture. The Huron Wendat Nation is aware of the sampling of Uxbridge bone and is a recipient of information from this study. We acknowledge the following sources of funding: European Research Council starting grant APGREID (to J.K.), the National Science Foundation (to A.C.S. and J.E.B.) for NSF BCS-1063939, NSF-REU BCS-0612222, and NSF BCS-0612222, the George E. Burch Fellow in Theoretic Medicine and Affiliated Sciences at the Smithsonian Institution (2003–2007, to J.E.B.), Social Sciences and Humanities Research Council of Canada postdoctoral fellowship grant 756-2011-501 (to K.I.B.), National Science Foundation Graduate Research Fellowship DGE-1311230 and Jacob K. Javits Fellowship (to K.M.H.), Ramón y Cajal Spanish research grant RYC-2012-10627 (to I.C.), Swiss National Science Foundation PP0033_119205 (to S.G.), National Institutes of Health AI090928 (to S.G.), European Research Council 309540 (to S.G.), PICT0575 Argentina (to R.A.G.), Wadsworth Fellowship from the Wenner-Gren Foundation (to T.J.C.), Wellcome Trust 098051 (to J.P., J.M.B. and S.R.H.), and funding from the Medical Research Council (to J.M.B.).
Author information
Authors and Affiliations
Contributions
A.C.S., J.E.B., J.K., K.I.B., and K.M.H. conceived the investigation. J.K., K.I.B., A.C.S., S.A.F., N.W., and A.K.W. designed experiments. J.P., R.A.G., D.L.W.S., D.C.C., S.N., M.A.B., M.Z., and R.B. provided samples for analysis. K.I.B., K.M.H., V.J.S., T.J.C., and A.K.W. performed laboratory work. A.H., J.K., S.G., M.C., N.W., K.I.B., I.C., D.Y., J.P., J.M.B., S.R.H., D.H., K.N., A.C.S., K.M.H., J.E.B., T.J.C., D.C.C., and D.L.W.S. performed analyses. K.I.B. wrote the manuscript with contributions from all co-authors.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Extended data figures and tables
Extended Data Figure 2 Histograms of SNP allele frequency distributions for the ancient samples and the Hungarian mummy sample using standard mapping parameters.
The x axis denotes the frequency of reads covering a SNP position in which the SNP was detected. The y axis denotes the number of observed SNP calls with the respective frequency. All variants with a SNP allele frequency below 90% are shown.
Extended Data Figure 3 Histograms of SNP allele frequency distributions for the ancient samples, the Hungarian mummy sample, and two modern isolates using stricter mapping and filtering parameters.
The x axis denotes the frequency of reads covering a SNP position in which the SNP was detected. The y axis denotes the number of observed SNP calls with the respective frequency. All variants with a SNP allele frequency below 90% are shown.
Extended Data Figure 4 Maximum parsimony analysis.
a, Maximum parsimony tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Subtree of the full maximum parsimony tree showing the lineage 6 and animal strains. Positions with missing data were excluded. Branches are labelled with the absolute number of substitutions. Internal nodes are labelled with bootstrap statistics obtained from 1,000 replicates.
Extended Data Figure 5 Maximum likelihood analysis.
a, Maximum likelihood tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Maximum likelihood subtree showing the lineage 6 and animal strains. Positions with missing data were excluded. Internal nodes are labelled with bootstrap statistics obtained from 200 replicates.
Extended Data Figure 6 Neighbour joining analysis.
a, Neighbour joining tree of all 262 samples of the complete data set. Positions with missing data were excluded. b, Neighbour joining subtree showing the lineage 6 and animal strains. Positions with missing data were excluded. Internal nodes are labelled with bootstrap statistics obtained from 1,000 replicates.
Extended Data Figure 7 Maximum clade credibility tree of M. tuberculosis.
The tree was estimated using the uncorrelated log-normal relaxed clock model in BEAST 1.7.5 (ref. 31). The radiocarbon dates of the ancient Peruvian strains were used as temporal estimates to date the tree. Branch lengths are scaled to years. Branch colours indicate the estimated branch substitution rate on the logarithmic scale shown in the legend at the left.
Extended Data Figure 8
a, Posterior distributions of times to most recent common ancestor (TMRCA) for different MTBC branches, and exponential growth and constant size models. b, Bayesian skyline plot showing estimated effective population sizes for the human lineages. c, Bayesian skyline plot showing estimated effective population sizes for the animal lineages.
Extended Data Figure 9 Maximum likelihood phylogeny of L4 lineage including modern and ancient strains.
The mixed samples are separated out into Hungarian 1 and 2. SNPs were mapped back onto the phylogeny, and branches marked in red are those defined by variants found to be mixed in the Hungarian sample. This allowed us to determine the ancestral nodes and branches for each of the two strains on the tree. The dotted lines represent the unknown length of the terminal branches, with the stars representing the theoretical penultimate node for which age priors were determined.
Extended Data Figure 10 Maximum clade credibility tree produced using BEAST31.
Produced using TreeAnnotator from 9,000 trees. Branch lengths are scaled by age. The mean age (yr bp) of the MRCA plus 95% HPD, and the position of the separated Hungarian ancient strains, are marked on the phylogeny.
Supplementary information
Supplementary Information (download PDF )
This file contains Supplementary Methods and archaeological descriptions, Supplementary Tables 2-4, 7, 10-11 and Supplementary References. (PDF 1072 kb)
Supplementary Table 1 (download XLSX )
Summary table of all samples subject to screening. (XLSX 25 kb)
Supplementary Table 5 (download XLS )
A list of all M. tuberculosis strains used for phylogeny and dating. (XLS 53 kb)
Supplementary Table 6 (download XLS )
This table contains mapping statistics for the three Peruvian tuberculosis strains. (XLS 31 kb)
Supplementary Table 8 (download XLS )
This table contains coverage statistics for all genomes used in analyses. (XLS 25 kb)
Supplementary Table 9 (download XLS )
This table contains SNPs identified in the animal cluster. (XLS 95 kb)
Rights and permissions
About this article
Cite this article
Bos, K., Harkins, K., Herbig, A. et al. Pre-Columbian mycobacterial genomes reveal seals as a source of New World human tuberculosis. Nature 514, 494–497 (2014). https://doi.org/10.1038/nature13591
Received:
Accepted:
Published:
Issue date:
DOI: https://doi.org/10.1038/nature13591



gabriel trueba
Evidence of tuberculosis in ancient Americans, prior to the Spanish conquest, has been provided by many reports, however the route of entry of the tuberculosis agent to the Americas has remained elusive; one of the most popular ideas is that M. tuberculosis came with the first Americans through the Bering Strait2. The novel idea presented by Bos, et al1. is not only fascinating but also controversial. For instance, the comparison of the 3 IS6110 DNA sequences obtained from: a lung lesion in a Chiribayan mommy (published in 1994)3, pre-Columbian human bones in Canada2, and Chiribayan human bones (published in 2014)1, shows a SNP which is only present in M. pinnipedii and the mycobacterial sequences reported by Bos et al1. (figure 1).
This SNP, in a conserved gene and in a bacterial species with little horizontal gene transfer, may indicate that the mycobacterial species detected by Bos et al. is not the same mycobacterial species detected previously in pre-Columbian human remains. Therefore besides an ancient M. pinnipedii, other members of Mycobacterium tuberculosis complex may have caused tuberculosis in the pre-Columbian Americans. It is possible that Chiribayan people contracted M. pinnipedii infection by the considerable use of sea lion´s meat, hides and bones, which was common practice in this region5.
References
1.	Bos, K.I. et al. Pre-Columbian mycobacterial genomes reveal seals as a source of New World human tuberculosis. Nature. doi:10.1038/nature13591 (2014)
2.	Braun, M., Collins Cook D., & Pfeiffer S. DNA from Mycobacterium tuberculosis Complex Identified in North American, Pre-Columbian Human Skeletal Remains." J. Archeol. Sci. 25, 271-277 (1998)
3.	Salo, W. et al. Identification of Mycobacterium tuberculosis DNA in a pre-Columbian Peruvian mummy. Proc. Natl Acad. Sci. USA 91,2091?2094 (1994)
4.	Eisenach, K.D., Cave M.D., Bates J.H., & Crawford J. T. Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J. Infec. Dis. 161,977-981 (1990)
5.	Standen, V. G., Santoro, C. M., & Arriaza, B. T. Síntesis y propuestas para el período arcaico en la costa del extremo norte de Chile. Chungará 36,201-212 (2004)
?
\	 60
M. canettii* 	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
M. africanum	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
M. bovis 	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
M. microti	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
M. tuberculosis 	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
Mycobacterium (Canada) Braun et al	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
Mycobacterium (Chiribaya-Peru) Salo et al	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGCCCAGGTCGA
Mycobacterium (Chiribaya-Peru) Bos et al. 	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGACCAGGTCGA
M. pinnipedii	ATCCTGCGAGCGTAGGCGTCGGTGACAAAGGCCACGTAGGCGAACCCTGACCAGGTCGA
Figure 1 Nucleotide sequences of IS6110 in members of M. tuberculosis Complex. Numbers indicate the location of nucleotides in IS6110 as shown in previous report4. The SNP is shown in red color. *M canettii has the two versions of the SNP.
?? ?
I am very confused with the inference that
* While a human transfer of the bacterium to marine mammals cannot be ruled out from our data, we consider this extremely unlikely: humans did not herd or farm seals, and close, regular contacts would be required for anthroponotic transmission, as is observed in domestic cattle.
Since regular contacts are rare, the possibility of transmission is rare either "from seal to human" or "from human to seal". How can the author only rule out the possibility of "from human to seal" by this condition?
After all, this paper provide a interesting insight of high Mycobacteria diversity in America.