Brief Report
18 July 2012

Development of an Efficient In Vivo System (Pjunc-TpaseIS 1223 ) for Random Transposon Mutagenesis of Lactobacillus casei

ABSTRACT

The random transposon mutagenesis system Pjunc-TpaseIS 1223 is composed of plasmids pVI129, expressing IS1223 transposase, and pVI110, a suicide transposon plasmid carrying the Pjunc sequence, the substrate of the IS1223 transposase. This system is particularly efficient in Lactobacillus casei, as more than 10,000 stable, random mutants were routinely obtained via electroporation.

TEXT

Lactic acid bacteria (LAB) are widely used in food fermentations, as well as for their probiotic properties. Lactobacilli delbrueckii subsp. bulgaricus and Lactobacillus casei have been shown to provide beneficial effects to the immune system (29, 35). However, due to the lack of reliable tools such as a random mutagenesis system to perform global reverse genetics, the overall mechanisms underlying their probiotic effects are poorly understood.
Neither the Gram-positive transposition systems based on transposon delivery by a suicide or a thermosensitive vector (19, 27, 34, 36) nor in vitro transposon mutagenesis using Tn5-based transposons (17) is adapted to all species of LAB, due to low transformation efficiencies or unwanted stability of the transposon delivery vector (23).
IS3 sequences are surrounded by imperfect inverted repeats (IR). They carry two consecutive and partially overlapping open reading frames, orfA and orfB, which encode a transposase. IS3 sequences undergo a “cut-and-paste” transposition mechanism that occurs by generating a covalently closed circular transposition intermediate, which promotes transposase induction resulting from the generation of a strong promoter named Pjunc. The Pjunc promoter corresponds to abutted IRR (inverted repeat right) and IRL (inverted repeat left) sequences as a result of insertion sequence circularization and constitutes an efficient transposition substrate (13, 14). Here, we report the construction of a novel in trans transposition procedure, named the Pjunc-TpaseIS1223 system and dedicated to in vivo random mutagenesis in LAB, and its application for random mutagenesis in L. casei. It is based on IS1223, a member of the IS3 family from Lactobacillus johnsonii (39) that transposes efficiently in Lactobacillus delbrueckii subsp. bulgaricus (31, 39). This system is composed of two plasmids: pVI129, carrying the IS1223 transposase gene, and pVI110, a suicide transposon plasmid carrying the Pjunc sequence, the substrate of the IS1223 transposase.

Construction of the Pjunc-TpaseIS1223 system and validation in Escherichia coli.

Plasmid pVI116 was constructed as described in Fig. 1 and its legend to provide the transposase of IS1223 expressed under the control of the L. delbrueckii subsp. bulgaricus PhlbA promoter (9). Plasmid pVI115 was constructed from pVI162 (see Table 1 for details of construction) to provide the transposition substrate corresponding to an abutted IRR-IRL junction of IS1223 separated by 3 base pairs, named Pjunc (Fig. 1A). It replicates only in the TG1 RepA strain of Escherichia coli (18). Plasmid pVI116 (PhlbA-TpaseIS1223) and the control plasmids, pGB2 and pVI113 (TpaseIS1223), were electroporated into E. coli TG1 as previously described (12). The resulting strains were electroporated with identical amounts (100 ng) of pVI115, as a nonreplicative source of the Pjunc, or pVI119 (Table 1), as a Pjunc-less nonreplicative control, and pGEMT, as a replicative plasmid. Cells were directly plated on LB agar plates supplemented with chloramphenicol (10 μg/ml) or ampicillin (50 μg/ml). Plates were incubated for 20 h at 37°C, and colonies were counted to score for integration or transformation. Since pVI115 cannot replicate in these E. coli strains, the resulting Cmr transformants were considered pVI115 chromosomal integrants. The integration efficiency obtained with pVI115 in the absence of TpaseIS1223 was very low (∼10−8) compared to that of the strain carrying a TpaseIS1223 without a cloned promoter (∼10−6), as well as that obtained with TpaseIS1223 fused to the PhlbA promoter (up to 10−3). In all strains, the integration efficiency of pVI119 was very close to the background level observed in the absence of identified promoter (10−8 to 10−7). These results clearly show that TpaseIS1223 triggers pVI115 integration using the Pjunc substrate in trans and that the PhlbA promoter drastically enhances the expression of TpaseIS1223 in E. coli. The transposon as developed in this work mimics the double-strand DNA intermediate and integrates as a nonreplicative element in the target sequence (Fig. 1C). The target sites of 19 integrants were determined by direct sequencing of genomic DNA (GATC Biotech) using the primer OLB215 (Table 2), which targets one transposon extremity (Fig. 1C). Fourteen insertions had occurred in different putative open reading frames; three were located in noncoding regions and two in repetitive extragenic palindromic (REP) sequences (data not shown). To confirm randomness of integration and saturation of the chromosome by pVI115, a pVI115-mutagenized Lac-positive (Lac+) E. coli strain culture was diluted and spread onto LB medium with X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) to screen Lac-negative (Lac) mutants. Of the 10 Lac clones analyzed, none was redundant, strongly supporting the randomness of integration and saturation of the E. coli chromosome by pVI115. Altogether, these results validated the fact that TpaseIS1223 is active in E. coli and efficiently recognizes Pjunc as a substrate leading to random transposition.
Fig 1
Fig 1 Diagram of plasmid construction. (A) Construction of the suicide transposon vector pVI110. (B) Construction of the transposase IS1223 (orf1-orf2)-delivering vector pVII129. orf1-orf2 are expressed under the promoter of the L. delbrueckii subsp. bulgaricus hblA gene (PhlbA). The characteristics of each plasmid are indicated in Table 1. The genes bla, aadA, cat, and ermB encode resistance to ampicillin, spectinomycin, chloramphenicol, and erythromycin, respectively. (C) Map of integration of pVI110 into genomic DNA by the action of Tpase IS1223 on Pjunc, with indication of primers OLB221 and OLB215 (Table 2) used for sequencing. XXX corresponds to the 3 to 4 base pairs duplicated during integration of pVI110 in the genomic target. Plasmids are not drawn to scale.
Table 1
Table 1 Bacterial strains and plasmids
Strain or plasmidRelevant markers, phenotypes, characteristics, and constructionReference or source
Strains  
    E. coli  
        TG1supE hsdΔ5 thi Δ(lac-proAB) F′ [traD36 proAB+ lacIq lacZΔM15]16
        TG1repATG1 derivative with repA gene integrated into the chromosome18
        TG1pGB2TG1 plus pGB2This work
        TG1pVI116TG1 plus pVI116This work
        TG1pVI113TG1 plus pVI113This work
    L. delbrueckii subsp. bulgaricus  
        VI104ATCC 11842 type strain32
        LBpVI129VI104 carrying pVI129This work
        LBpVI1056VI104 carrying pVI1056This work
    L. casei  
        LC334ATCC 334 type strainCollection Institut Pasteur, France
        LCpVI129L. casei ATCC 334 carrying pVI129This work
        LCpVI1056L. casei ATCC 334 carrying pVI1056This work
Plasmids  
    For construction of pVI115 and pVI116 and experiments with E. coli  
        pBluescriptSKApr, pBR322ori1
        pBSHUApr, pBluescriptSK containing 317 bp of L. delbrueckii subsp. bulgaricus hlbA promoter region9
        pGB2Spr, pSC101ori10
        pGEM-TApr, pBR322ori, f1ori, linear T-overhang vectorPromega
        pJIM2242Ermr, pWV01ori18
        pVI42Apr, pBluescriptSK IS1223 cloned at ClaI and EcoRI sites31
        pVI62pVI42 with abutted Pjunc, generated by cloning the two complementary oligonucleotides OLB187 and OLB188 between the ClaI site treated with exonuclease VII and the XhoI site of pVI42This work
        pVI105Apr, pGEM-T with a 136-bp sequence containing Pjunc amplified with OLB131 and OLB203 primers using pVI62 as a templateThis work
        pVI107Cmr, pGEM-T containing the cat gene from pACYC184This work
        pVI108Emr, pJIM2242 containing the Pjunc SpHI-PstI fragment (185 bp) of pVI105This work
        pVI111Apr, pGEM-T containing IS1223ΔIRThis work
        pVI113Spr, pGB2 containing IS1223ΔIRThis work
        pVI115Cmr, pWV01oriΔrepA, Pjunc, obtained by ligation of the SpHI-EcoRII (extremity filled in with the Klenow fragment) Pjunc-containing fragment of pVI108 and the SpHI-HincII fragment (carrying the cat gene from pACYC184) of pVI107This work
        pVI116Spr, pGB2 containing PhlbA-IS1223ΔIRThis work
        pVI119Cmr, pVI115ΔPjunc, obtained by self-ligating pVI115 digested with HincII-SchIThis work
        pVI138Emr, E. coli-L. delbrueckii subsp. bulgaricus shuttle vectorThis work
    For construction of pVI110 and pVI129 and experiments with lactobacilli  
        pGB3631Emr, pIP501 derivative6
        pGKV259Cmr, Gram/Gram+ shuttle vector38
        pIP501Emr, Gram/Gram+ shuttle vector, containing the replication origins from pBluescriptSK for Gram and from pIP501 for Gram+, including the copy number-controlling copR gene22
        pMUTIN2Apr Emr, pBR322ori37
        pUC1318Apr, pBR322ori24
        pVI70Emr, pUC1318 containing the ermB gene from pMUTIN2This work
        pVI110Emr, pBR322ori, PjuncThis work
        pVI129Apr Cmr, pVI1056 containing PhlbA-IS1223ΔIRThis work
        pVI137Emr, pBR322oriThis work
        pVI1052Apr Emr, pBR322ori, pIP501ori, obtained by ligation of pGB3631 and pBluescriptSK at EcoRI-BamHI sitesThis work
        pVI1056Apr Cmr, pBR322ori, pIP501ori, cop+, low-copy-number replicative plasmid in L. delbrueckii subsp. bulgaricus, obtained by ligation of the XhoII fragment (extremities filled in with the Klenow fragment) containing the Cm resistance (cat-86) cassette fragment of pGKV259 and the Eco47III-XbaI (extremity filled in with the Klenow fragment) of pVI1052This work
Table 2
Table 2 Primers
Primer use and nameSequence (5′ to 3′)aTarget
Plasmid construction  
    ERYFGTTGATAGTGCAGTATCTTAermC
    ERYRCTTGCTCATAAGTAACGGTACermC
    IRLL-PjuncGATCTTTATGTCTAACAATTATGAGGCpVI62
    IRLR-PjuncAAGTGCCTCATAATTGTTAGACATAAAACGACTCCTGTAAAATACAGpVI62
    M13revAACAGCTATGACCATGpVI62
    OLB93AATGTAGGAAAGAAAGCACCpVI62
    OLB131ACGACTCCTGTAAAATACAGM13-OLB93 amplicon
    OLB187TCGAATGTCTAACTTTTCTATGGCACTTCComplementary to OLB188
    OLB188GAAGTGCCATAGAAAAGTTAGACATComplementary to OLB187
    OLB203AAAATACCTCATAATTATTAGATTTTATGTCTAACAATTATGAGGCACM13-OLB93 amplicon
    OLB204AAATCTGCAGTTATGAGGTATTTTTTTATGACCIS1223
    OLB205ACATTTCTCGAGTTTTAAAGATTTGATAATACACGIS1223
pVI110 target sequencing  
    OLB215ATGGCCGCGGGATTACGACTCCpVI110
    OLB221AGCTATGCATCCAACGCGTTGGGpVI110
Plasmid copy no. in L. casei  
    LSEI0004FACCACCACAAGTTTGGAAGGLSEI_0004
    LSEI0004RTCACGCTCTTGCTAATGTCCLSEI_0004
    LSEI0145FCGAAACCGAGGACTTGTTGLSEI_0145
    LSEI0145RAATGTGCGGGCTGAGAACLSEI_0145
    LSEIA04FACTGGCACCAACGGATAGTCLSEA_04 (pLSEIA)
    LSEIA04RGATGGCATTGAGACGACAGALSEA_04 (pLSEIA)
    LSEIA13FTTTGTTCGCTATCGGTTTCCLSEIA_13 (pLSEIA)
    LSEIA13RAGTGGTTGATCGCACGACTALSEIA_13 (pLSEIA)
a
Underlined bases indicate PstI restriction sites.

Pjunc-TpaseIS1223 in vivo transposon mutagenesis in L. delbrueckii subsp. bulgaricus and in L. casei.

The highly efficient Pjunc-TpaseIS1223 transposition system was adapted to LAB, namely, L. delbrueckii subsp. bulgaricus and L. casei. PhlbA-TpaseIS1223 was cloned in the E. coli–Gram-positive bacterium shuttle vector, pVI1056, to give pVI129 (Fig. 1B and Table 1), a plasmid providing the TpaseIS1223. Plasmid pVI129 possesses the pIP501 replication origin, which is thermosensitive in several Gram-positive bacteria (4, 15, 21, 26, 30), including L. delbrueckii subsp. bulgaricus (31). This property allows the efficient elimination of the transposase-expressing plasmid so as to avoid further transposition events. The Pjunc sequence was combined with the erythromycin resistance cassette ermB to generate pVI110 (Fig. 1A), the suicide transposon plasmid.
L. delbrueckii subsp. bulgaricus VI104 and L. casei LC334 cells were first transformed with pVI129 as previously described (2, 32), and the resulting strains, LBpVI129 and LCpVI129, respectively, were then electroporated with 4 μg of pVI110, an optimal amount determined by preliminary assays with different amounts of plasmid DNA (data not shown). The cells were directly plated on MRS agar plates supplemented with erythromycin (5 μg/ml), and the plates were incubated for 2 days at 42°C or 37°C for VI104 and LC334 strains, respectively, under static anaerobic growth conditions. The Emr colonies obtained after transformation with suicide transposon pVI110 were considered genomic (chromosome or indigenous plasmid) integrants. The transposition efficiency was determined by the number of Emr colonies obtained for 50 μl of electrocompetent cells with 1 μg of pVI110 plasmid. With LBpVI129, the number of integrants was estimated between 300 and 1,500 for ∼2 × 108 viable cells, while with LCpVI129, this number reached between 2,500 and 7,500 for ∼109 viable cells in more than 10 independent experiments. These results demonstrate that Pjunc-TpaseIS1223 is functional and efficient in the two species. Negative controls were made using two other combinations of plasmids introduced successively: (i) pVI1056, as a TpaseIS1223-nonexpressing vector, and pVI110 and (ii) pVI129 and pVI137, a Pjunc-less plasmid. For the two strains, less than 10 Emr colonies were obtained using these plasmid combinations. These last data show that the Pjunc is not the substrate of a genomic indigenous putative transposase produced by L. delbrueckii subsp. bulgaricus or L. casei and that Pjunc is strictly required for pVI110 integration in these two species.
Preliminary results (data not shown) revealed that the growth of L. casei was seriously affected at temperatures above 40°C, making the elimination of pVI129 at a high temperature undesirable. The segregational stability of pVI129 in L. casei at 37°C was estimated at 86% per generation as described by Heap et al. (20). Thus, the inherent pVI129 instability and the resulting loss of TpaseIS1223 in L. casei mutants considerably limit the risk of genomic instability of the mutants.

Analysis of pVI110 integration in L. delbrueckii subsp. bulgaricus and L. casei.

pVI110 insertion mutants of L. delbrueckii subsp. bulgaricus and L. casei were randomly selected. Mutant genomic DNA digested by NgoMIV for L. delbrueckii subsp. bulgaricus and by HindIII for L. casei was analyzed by Southern hybridization with a pVI110-specific probe generated by PCR amplification with primers ERYF and ERYR (Table 2). Plasmid pVI110 integrated in a single locus in each mutant, except for mutant 2 of L. casei, which presented two bands of different intensity, suggesting two distinct mutants in the sample (Fig. 2). Overall, the diversity of fragment sizes among the tested clones indicated that pVI110 had inserted randomly into both the L. delbrueckii subsp. bulgaricus and L. casei genomes. L. casei strain LC334 carries pLSEIA (GenBank accession number NC_008502.1), a 29-kbp indigenous plasmid. Since indigenous plasmids are often targets of preferential insertion, leading to a reduction in efficiency of random transposon mutagenesis in chromosomal targets (28), we determined the plasmid copy number (PCN) of pLSEIA by quantitative PCR (qPCR). Real-time PCRs were performed as previously described (25) from whole DNA of L. casei with primer pairs LSEI0004F-LSEI0004R and LSEI0145F-LSEI0145R (for the chromosome) and LSEIA04F-LSEIA04R and LSEIA13F-LSEIA13R (for pLSEIA) (Table 2). The PCN was determined using the following equation: PCN = (Ec)CTc/(Ep)CTp, considering different amplification efficiencies [E = 10(−1/slope)] and cycle threshold (CT) values for the two amplicons (chromosome, c, and plasmid, p) (33). The PCN of pLSEIA was estimated at 2.8 ± 1.4 (mean ± standard deviation) plasmid copies per chromosome (from 3 independent DNA extracts). Taking into account the respective sizes of pLSEIA (29 kbp) and the L. casei chromosome (2.9 Mbp), the theoretical percentage of pVI110 nonpreferential integration in pLSEIA should be between 1 and 5%.
Fig 2
Fig 2 Diversity of pVI110 integration in L. delbrueckii subsp. bulgaricus and L. casei. Southern analysis of 11 L. delbrueckii subsp. bulgaricus integrants' DNA restricted by NogMIV and 12 L. casei integrants' DNA restricted by HindIII with a 32P-labeled pVI110-ermB probe. R, Raoul molecular weight marker; (−), no DNA sample.
To confirm the diversity of mutants and to identify the nature of the target sequences of the pVI110 transposon, the randomly selected mutants were identified by genomic DNA sequencing with primers OLB215 and OLB221 (Table 2), which target the transposon sequence extremities (Fig. 1C and Table 3). In regard to L. delbrueckii subsp. bulgaricus, more than 80% (n = 17) of sequenced targets were located in intergenic regions (IGR). Although four mutants were obtained in the IGR Ldb2086/Ldb2087, the target sequences of the pVI110 insertions were different, suggesting that this region is most likely not a hot spot of integration. Noticeably, target sites are surrounded by inverted repeats predicted to form hairpins with ΔG < −9 Kcal (calculated with Oligo Analyser freeware). Alignment of pVI110 target sequences revealed a preferential insertion in A/T-rich regions, as seen for other mobile elements, like Tn1545 in Clostridium and Listeria (5, 8), and several insertion sequences (11, 28). The nucleotide sequences of pVI110-target junctions in L. delbrueckii subsp. bulgaricus also revealed a 3-bp (occasionally 4-bp) duplication generated upon integration. Analysis of the target sequences suggests that triplets C/A A/T T/A may be preferential target sites for pVI110 in L. delbrueckii subsp. bulgaricus. Of the 20 random pVI110 transposon targets sequenced for L. casei (Table 3), 50% (n = 10) were located in intergenic regions, while the L. casei genome contains about 20% noncoding regions (7). Ten percent (n = 2) of mutants correspond to two different integration sites of pVI110 in pLSEIA, which represents only twice the maximal theoretical rate. This result reveals that pLSEIA is not a significant preferential host for pVI110 integration, indicating that the presence of the pLSEIA plasmid in LC334 is not an obstacle to obtaining saturated mutagenesis libraries. In contrast to the results for L. delbrueckii subsp. bulgaricus, only 20% of the L. casei target sites were located in inverted repeats predicted to form hairpins. Moreover, no preferential insertion in A/T-rich regions was observed. Despite the general, presumed random insertion of most transposons, many of them show a target preference (for reviews, see references 11 and 28). This targeting could in fact be a result of selective means to avoid affecting host fitness and, consequently, to promote transposon dissemination. Since L. delbrueckii subsp. bulgaricus is closely related to L. johnsonii, the original host of IS1223 (39), IS1223 is likely to preferentially target noncoding sequences to preserve its host genome. Interestingly, this bias is reduced in L. casei, which is phylogenetically more distant from L. johnsonii (3, 40), and is reduced even further in E. coli, suggesting that insertion sequences may display a more random integration in phylogenetically distant bacteria.
Table 3
Table 3 Identification of target in independent L. delbrueckii subsp. bulgaricus and L. casei pVI110 integrants
Species and integrantapVI110 insertion site sequencebLocus of pVI110 insertionc
L. delbrueckii subsp. bulgaricus  
    Lb1TTTCTTGGAATTAAAGCGCATAGTTA|AATCACTTCTTTCTTTTTCTTCTTTTCTTIGR Ldb2182/Ldb2183
    Lb2TAAAAAAGTCTCGCTGAAAAGCGGGA|CTTTTTTGCGCCTTTGACGTGATTTTACAIGR Ldb1406/Ldb1407
    Lb3AGATCATTCTTCAAAAAGAGCTCCCG|GAATCCGGGAGCTCTTTTGCTTTAGTTAALdb0913
    Lb4AAAACAATACGAAGCAAAAGCAAGAA|GAAAAAGCATGTTTGAAAAAACATGCTTTIGR Ldb0494/ldb0501
    Lb5TGAGACCTATGTAAGAAGCTCAGGTC|CACAGGACCGAGCTTCTTTTGTGCTTTTAIGR Ldb2110/Lbd2112
    Lb6CATAAGCAACAAAAAAGCAGTCATTC|CATCGATGACTGCTTTTCTGCTGCTGTGTIGR Ldb0218/Ldb0219
    Lb7CGATAAAAAAGAAGGTCAGCGCGGCA|AAAAGCGCTGGCCTTTTTAAATTAGATTTIGR Ldb2015/Ldb2020
    Lb8CAGAATTTAGAGCAAAGTAAAAGCCG|CTTTTCAGCGGCTTTTATTTTTTTCTTGTIGR Ldb1491/Ldb1492
    Lb9GATGACAAAAACAGGCTGAGGCCTAT|TTTTATTTTGCCTTTTTTCTTCTTTTTTTIGR Ldb1733/Ldb1734
    Lb10CAAATAGCAAAGAAAAAACTAGCTGA|AAAATCAGCTAGTTTTTTCTTTTTCCCGTIGR Ldb0968/Ldb0968
    Lb11ACAAAGCTTTAAAAAGCGCTACAGGA|CAACTTGCAGCGCTTTTTAGTTTTGTAATIGR Ldb0164/Ldb0165
    Lb12AAGCCGCCAACTACGGAATCTTGGAC|CTTGCCAAAAGCCCCGGTTACTTTTTCCGLdb2064
    Lb13ATGTAGAAAAGAAAACGAAGCTGCTC|AAAGTGAGTAGCTTCGTTTTTTGCTATTAIGR Ldb2034/Ldb2036
    Lb14TGTAACCTAAACTAATCCTTTTGGCA|ATTTTCCTGGGCTTTTTTTGCTAATTTTTLdb1636
    Lb15ACAAAAATCTTGCTTAACTAATTGCA|TTATATAACGGCTTTTTTGAATTTTGTTAIGR Ldb2086/Ldb2087
    Lb16ATACAAGGAAAAAAAGAGCTCCAGAA|CTTGCTAAACGCTTCTGAAGCTCTTTCTTIGR Ldb2086/Ldb2087
    Lb17AATCAAACGAAAAAGCTTCAGTAAAG|CAATACTGAAGCTTTTTTCATTGCTATTAIGR Ldb2090/Ldb2091
    Lb18TAGCAATGAAAAAAGCTTCAGTATTG|CTTTACTGAAGCTTTTTCGTTTGATTCTAIGR Ldb2090/Ldb2091
    Lb19ATACAAGGAAAAAAAGAGCTCCAGA|ACTTGCTAAACGCTTCTGAAGCTCTTTCTTIGR Ldb2086/Ldb2087
    Lb20AAGAAAGAGCTTCAGAAGCGTTTAG|CAAGTTCTGGAGCTCTTTTTTTCCTTGTATIGR Ldb2086/Ldb2087
L. casei  
    Lc1CGCTGGCGGATTATGTGACACCGGAAA|ATGACTGGGAGCCGCTCAATTTTTCAGLSEI_1278
    Lc2AAAAAAGCTCACGTTTTGCGACGTGAG|CTTTTTTGGTGCCGTCAGAACAAGTTAIGR LSEI_1440/LSEI_1441
    Lc3AGTGAAGCTCCAGACCGTGAATTACAC|AACGGTGAAAAAACCATCAACGGTTCTLSEI_1892
    Lc4GTCACCGATGACAGCGCCAAGCTTTTC|CGCGATTTGCCAAAAGATCAAACCGTCLSEI_1979
    Lc5TACACTGATGTTGAGAGATCAACATCA|GTGTACAGCTCTTTTATTTTGGGCCTAIGR LSEI_2050/LSEI_2051
    Lc6TTTTTGGTTAAGGGCTTTTAATTTAGC|TTGTTTTTCTAAGTTACTTTGCGACATIGR LSEI_A13/LSEI_A14
    Lc7CTTTGTGCTTATGCTGGGGATTGGAAT|TCTTAGACTGTTTTTTTCGTTTTTTACLSEI_0106
    Lc8TAAAAAGTGGCCCCGCGTAAATACTGC|AACGAGGCCACTTTTTATATTTATGGGIGR LSEI_2579/LSEI_2580
    Lc9ACTCAGGTGATTTCACATAGCTCCATG|TTGCCTGAGAGCCTTTTAATTTAGGCALSEI_0797
    Lc10TGACCGGCAGGGTCATTGTCGGAGCCA|ACATAAATAGTGGCTGGCAATTGCCCTLSEI_0548
    Lc11ATTCAAAAAAAGTTAAAAGACTTTGCT|AAACACAATCCAGAAATTAAGGCAAAAIGR LSEI_A13/LSEI_A14
    Lc12TGGCCCTGCGTAATTTGACTTGAAACA|ACTGTTGGAAAGTTCTTTAATTTTTCTLSEI_0374
    Lc13GTTGGCAGTCAGCAAGTCGCTTTAAAA|GCAGTCACCAATCAGAAAGACTATGATLSEI_2769
    Lc14GACGAAAAAACAAAGAAGGTATCAGCC|TAAACGCCGGTACCTTCTTTATTATCTIGR LSEI_0637/LSEI_0638
    Lc15ATCAAAGATACTAAACAGCTTCTTAAG|AGATTTTAGACAGCTTCTAAACACCATIGR LSEI_0343/LSEI_0344
    Lc16TTCTTGCTCAACAAAAAAACCACCACG|AGGGTGGAAAAGTTTGGGGGAACTTTTIGR LSEI_2568/LSEI_2569
    Lc17TTCAGGTGCAGCAAAAACAGTTTACCG|ATACGCAACTCGAAACTGCTACGAGTTLSEI_2855
    Lc18CTGAACTCTTTGGCCTTGGAAAATCAG|ATAGGTAGTTTTGACGTTCTATTTCCTLSEI_1966
    Lc19CCATAAGGAACACATGCACAATGCCCA|AAAAAGACCATTGCATTTGTGCGCCGAIGR LSEI_1566/1567
    Lc20CGCGTTACTAAAAAGAAGCTATATCTG|ATGCACAGCATTCTGCTGGGCGCGATAIGR LSEI_2333/LSEI_2334
a
Lb and Lc indicate L. delbrueckii subsp. bulgaricus and L. casei, respectively, in integrant designations.
b
Inverted repeat sequences are underlined, and vertical bars are pVI110 insertion sites.
c
IGR, intergenic region.
In conclusion, this work describes the use of an IS3-like transposition mechanism to engineer a novel transposition system based on the Pjunc-TpaseIS1223 two-plasmid system for Gram-positive bacteria. Our results demonstrate that this system is functional in L. delbrueckii subsp. bulgaricus and L. casei and produces a high rate of stable integrants (at least 10,000 mutants per transformation for L. casei) despite the relatively poor transformation rate of lactobacilli. This system presents the advantage of promoting transposition of a suicide plasmid which contains Pjunc (pVI110) provided in trans with a helper plasmid (pVI129) supplying TpaseIS1223. Thanks to this design, no sibling clones from early transposition events (31) can appear, and as pVI110 is stably produced in E. coli, it can be easily manipulated by inserting a reporter gene or used for signature-tagged mutagenesis. In view of the efficient transposition activity observed in the species tested (e.g., Bacillus subtilis, Lactococcus lactis, Lactobacillus plantarum, and Enterococcus faecalis; unpublished results), this transposition system may have a broad application in Gram-positive bacteria, particularly in LAB.

ACKNOWLEDGMENTS

We thank P. Polard for stimulating discussions on transposition mechanisms which led us to initiate this work. We also thank S. Kulakauskas for sharing data on L. lactis. We are grateful to Ellen Arena for the English revision of the manuscript.
This work was supported by ERC Advanced grant HOMEOEPITH.

REFERENCES

1.
Alting-Mees MA, Sorge JA, and Short JM. 1992. pBluescriptII: multifunctional cloning and mapping vectors. Methods Enzymol. 216:483–495.
2.
Aukrust TW, Brurberg MB, and Nes IF. 1995. Transformation of Lactobacillus by electroporation. Methods Mol. Biol. 47:201–208.
3.
Berger B et al. 2007. Similarity and differences in the Lactobacillus acidophilus group identified by polyphasic analysis and comparative genomics. J. Bacteriol. 189:1311–1321.
4.
Bhowmik T, Fernandez L, and Steele JL. 1993. Gene replacement in Lactobacillus helveticus. J. Bacteriol. 175:6341–6344.
5.
Blouzard JC, Valette O, Tardif C, and de Philip P. 2010. Random mutagenesis of Clostridium cellulolyticum by using a Tn1545 derivative. Appl. Environ. Microbiol. 76:4546–4549.
6.
Brantl S, Kummer C, and Behnke D. 1994. Complete nucleotide sequence of plasmid pGB3631, a derivative of the Streptococcus agalactiae plasmid pIP501. Gene 142:155–156.
7.
Cai H, Thompson R, Budinich MF, Broadbent JR, and Steele JL. 2009. Genome sequence and comparative genome analysis of Lactobacillus casei: insights into their niche-associated evolution. Genome Biol. Evol. 1:239–257.
8.
Choi KH and Kim KJ. 2009. Applications of transposon-based gene delivery system in bacteria. J. Microbiol. Biotechnol. 19:217–228.
9.
Chouayekh H, Serror P, Boudebbouze S, and Maguin E. 2009. Highly efficient production of the staphylococcal nuclease reporter in Lactobacillus bulgaricus governed by the promoter of the hlbA gene. FEMS Microbiol. Lett. 293:232–239.
10.
Churchward G, Belin D, and Nagamine Y. 1984. A pSC101-derived plasmid which shows no sequence homology to other commonly used cloning vectors. Gene 31:165–171.
11.
Craig NL. 1997. Target site selection in transposition. Annu. Rev. Biochem. 66:437–474.
12.
Dower WJ, Miller JF, and Ragsdale CW. 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16:6127–6145.
13.
Duval-Valentin G, Marty-Cointin B, and Chandler M. 2004. Requirement of IS911 replication before integration defines a new bacterial transposition pathway. EMBO J. 23:3897–3906.
14.
Duval-Valentin G, Normand C, Khemici V, Marty B, and Chandler M. 2001. Transient promoter formation: a new feedback mechanism for regulation of IS911 transposition. EMBO J. 20:5802–5811.
15.
Evans RP Jr and Macrina FL. 1983. Streptococcal R plasmid pIP501: endonuclease site map, resistance determinant location, and construction of novel derivatives. J. Bacteriol. 154:1347–1355.
16.
Gibson TJ. 1984. Studies on the Epstein-Barr virus genome. Ph.D. thesis. Cambridge University, Cambridge, United Kingdom.
17.
Goryshin IY, Jendrisak J, Hoffman LM, Meis R, and Reznikoff WS. 2000. Insertional transposon mutagenesis by electroporation of released Tn5 transposition complexes. Nat. Biotechnol. 18:97–100.
18.
Guedon E, Serror P, Ehrlich SD, Renault P, and Delorme C. 2001. Pleiotropic transcriptional repressor CodY senses the intracellular pool of branched-chain amino acids in Lactococcus lactis. Mol. Microbiol. 40:1227–1239.
19.
Gury J, Barthelmebs L, and Cavin J-F. 2004. Random transposon mutagenesis of Lactobacillus plantarum by using the pGh9:ISS1 vector to clone genes involved in the regulation of phenolic acid metabolism. Arch. Microbiol. 182:337–345.
20.
Heap JT, Pennington OJ, Cartman ST, and Minton NP. 2009. A modular system for Clostridium shuttle plasmids. J. Microbiol. Methods 78:79–85.
21.
Hershfield V. 1979. Plasmids mediating multiple drug resistance in group B Streptococcus: transferability and molecular properties. Plasmid 2:137–149.
22.
Horodniceanu T, Bouanchaud DH, Bieth G, and Chabbert YA. 1976. R plasmids in Streptococcus agalactiae (group B). Antimicrob. Agents Chemother. 10:795–801.
23.
Ito M et al. 2010. A practical random mutagenesis system for probiotic Lactobacillus casei using Tn5 transposition complexes. J. Appl. Microbiol. 109:657–666.
24.
Kay R and McPherson J. 1987. Hybrid pUC vectors for addition of new restriction enzyme sites to the ends of DNA fragments. Nucleic Acids Res. 15:2778.
25.
Licandro-Seraut H, Gury J, Tran NP, Barthelmebs L, and Cavin JF. 2008. Kinetics and intensity of the expression of genes involved in the stress response tightly induced by phenolic acids in Lactobacillus plantarum. J. Mol. Microbiol. Biotechnol. 14:41–47.
26.
Luchansky JB, Muriana PM, and Klaenhammer TR. 1988. Application of electroporation for transfer of plasmid DNA to Lactobacillus, Lactococcus, Leuconostoc, Listeria, Pediococcus, Bacillus, Staphylococcus, Enterococcus and Propionibacterium. Mol. Microbiol. 2:637–646.
27.
Maguin E, Prévost H, Ehrlich SD, and Gruss A. 1996. Efficient insertional mutagenesis in lactococci and other gram-positive bacteria. J. Bacteriol. 178:931–935.
28.
Mahillon J and Chandler M. 1998. Insertion sequences. Microbiol. Mol. Biol. Rev. 62:725–774.
29.
Marco ML, Pavan S, and Kleerebezem M. 2006. Towards understanding molecular modes of probiotic action. Curr. Opin. Biotechnol. 17:204–210.
30.
Pujol C, Chedin F, Ehrlich SD, and Janniere L. 1998. Inhibition of a naturally occurring rolling-circle replicon in derivatives of the theta-replicating plasmid pIP501. Mol. Microbiol. 29:709–718.
31.
Serror P, Ilami G, Chouayekh H, Ehrlich SD, and Maguin E. 2003. Transposition in Lactobacillus delbrueckii subsp. bulgaricus: identification of two thermosensitive replicons and two functional insertion sequences. Microbiology 149:1503–1511.
32.
Serror P, Sasaki T, Ehrlich SD, and Maguin E. 2002. Electrotransformation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis with various plasmids. Appl. Environ. Microbiol. 68:46–52.
33.
Skulj M et al. 2008. Improved determination of plasmid copy number using quantitative real-time PCR for monitoring fermentation processes. Microb. Cell Fact. 7:6. doi:.
34.
Steinmetz M and Richter R. 1994. Easy cloning of mini-Tn10 insertions from the Bacillus subtilis chromosome. J. Bacteriol. 176:1761–1763.
35.
Tien MT et al. 2006. Anti-inflammatory effect of Lactobacillus casei on Shigella-infected human intestinal epithelial cells. J. Immunol. 176:1228–1237.
36.
Tran NP et al. 2008. Phenolic acid-mediated regulation of the padC gene, encoding the phenolic acid decarboxylase of Bacillus subtilis. J. Bacteriol. 190:3213–3224.
37.
Vagner V, Dervyn E, and Ehrlich SD. 1998. A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144 (Pt 11): 3097–3104.
38.
van der Vossen JM, van der Lelie D, and Venema G. 1987. Isolation and characterization of Streptococcus cremoris Wg2-specific promoters. Appl. Environ. Microbiol. 53:2452–2457.
39.
Walker DC and Klaenhammer TR. 1994. Isolation of a novel IS3 group insertion element and construction of an integration vector for Lactobacillus spp. J. Bacteriol. 176:5330–5340.
40.
Zhang ZG, Ye ZQ, Yu L, and Shi P. 2011. Phylogenomic reconstruction of lactic acid bacteria: an update. BMC Evol. Biol. 11:1.
American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy