Original Article

The more potential performance of nidogen 2 methylation by tissue or plasma DNA over brichoalveolar lavage DNA in diagnosis of nonsmall cell lung cancer

Feng, Xu; Xie, Xiaoyong; Zheng, Baoshi; Peng, Chaoyang; Zhou, Huafu; Qin, Jiajin

Author Information
Journal of Cancer Research and Therapeutics 14(Suppl 2):p S341-S346, June 2018. | DOI: 10.4103/0973-1482.235352
  • Open

Abstract

Background: 

Nonsmall cell lung cancer (NSCLC) is one of the leading incidence and mortality of malignant tumors worldwide. While aberrant DNA methylation is a frequent event occurred during NSCLC carcinogenesis and development, therefore holding the potential to predict the process of tumor development. This study aims to explore the feasibility of gene nidogen 2 (NID2) as the diagnostic biomarker for NSCLC.

Materials and Methods: 

Quantitative methylation specific polymerase chain reaction of NID2 has been done among the following sample panels: For tissue methylation evaluation, we collected 96 cases of NSCLC versus 18 cases of noncancerous lung lesions (NCLLs); 46 from the 96 NSCLC patients also provided DNA of bronchoalveolar lavage (BAL) and plasma sample, the methylation status of which are assessed against 12 cases of NCLL for BAL and 30 cases of NCLL for plasma samples, respectively.

Results: 

The methylation rate of NID2 in NSCLC versus NCLL is evaluated as: In tissue 59.40% versus 16.67%, (P = 0.0001); in BAL 30.43% versus 16.67% (P = 0.1640); in plasma 45.65% versus 20.00% (P = 0.0191).

Conclusions: 

Our study revealed the frequent occurrence of aberrant NID2 methylation in NSCLC and peripheral blood, which might be useful as a biomarker to predict NSCLC or to screen the high-risk population for NSCLC.

INTRODUCTION

Lung cancer is one of the deadly malignant tumors in both male and female worldwide.[1] In China, lung cancer has become a leading killer in cancer related modality.[2] Nonsmall cell lung cancer (NSCLC), as a popular kind of malignant tumor in the lung, accounts 85–95% of the total lung cancers.[3] Its 5-year-survivial rate is varied between 2% and 47% depending on the clinical stage and histological-pathological categories.[4] Although the novel development has been made in the treatment of this deadly disease, the overall survival rate is not satisfactory. Therefore, the early diagnosis plays a critical role in the improvement of NSCLC prognosis.[5]

The aberrant DNA methylation in gene promoter constitutes a high frequent occurring event,[6] but also take place at the pretty early stage during the whole process of tumorigenesis.[78] This kind of tumor related epigenetic alteration, has been extensively studied in terms of the possible biomarker in broad malignant tumors, lung cancer included.[8910] In addition to tumor tissue, many remote media, such as blood, saliva, sputum, and urine have been subjected to study, thereby revealing their potential in clinical applications.[111213]

In our previous study,[14] we revealed the hypermethylation of nidogen 2 (NID2) promoter in tumor tissue of stage I NSCLC patients. In this work, we extended our study by evaluating the methylation status of NID2 in various clinical stages of NSCLC, along with the comparison of NID2 methylation in tissue, bronchoalveolar lavage (BAL), and plasma from the same panel of NSCLC patients. We uncovered 65% hypermethylation with NID2 gene in NSCLC tumor tissue, meanwhile, common DNA methylation has also been found in BAL and plasma, but with a high sensitivity in plasma than in BAL. Thus, this study demonstrated that NID2 DNA methylation holds the potential to predict NSCLC as a minimally invasive biomarker.

MATERIALS AND METHODS

Nonsamll cell lung cancer clinical tissue samples and DNA extraction

Totally 96 cases of primary NSCLC tissues were collected during the time range from January to November of 2011. In addition, 18 cases of noncancerous lung lesions (NCLLs) tissues were also obtained as a nontumor control [Table 1]. Fresh tissue samples were frozen in liquid nitrogen immediately during tumor resection and kept at −80°C. All the patient had not been received any chemotherapy or radiotherapy. The pathological definition and category were according to the tumor node metastasis staging system (7th edition).[15] In addition to the tissue samples, BAL and peripheral blood (ethylenediaminetetraacetic acid anti-coagulated) of 46 cases also collected from the same panel of 96 NSCLC patients mentioned above. Meanwhile, 12 cases of NCLL BAL and 30 cases of NCLL peripheral blood were included as a control. BAL was collected during bronchoscopy procedure, 30 ml sterile saline flush were used and centrifuged at 1800 ×g to obtain the cell pellet, store at −80°C. The peripheral blood samples were stored at 4°C before plasma separation, and the tissue samples were stored at −80°C until DNA extraction. All clinical tissue samples were obtained with informed consent, and all procedures were performed in accordance with the China Ethical Review Committee. The tissue DNA and plasma cell-free DNA (cf-DNA) were isolated as previously described;[11] the DNA isolation from cell pallet of BAL was performed as reported previously.[12]

T1-13
Table 1:
Clinical profile of the NSCLC cancer patients and controls

Bisulfite conversion and quantitative methylation-specific polymerase chain reaction

The tissue DNA, BAL DNA, and plasma cf-DNA were bisulfite converted as describe previously.[11] All of the DNA (converted or unconverted) samples were stored at −80°C until analysis. Quantitative methylation specific polymerase chain reaction (q-MSP) were performed on a 7500 high-throughput real-time polymerase chain reaction (PCR) system (applied biosystems), in 20 μl of PCR reaction volume containing 10 μl of bisulfited DNA template, and primers (0.25 μM/each, Sense: TTACGGTTGAGTTTTCGTCGTC; Antisense: CGACCGATACTATCGTCGTTACC), FAM labeled probe (0.25 μM, CGTTTGGGTGTAGCGTCGCGG). MSP location are shown in Figure 1a. The thermo cycle condition of PCR include 5 min at 95°C; followed by 45 cycles of 15 s at 95°C, 20 s at 58°C, and 20 s at 72°C. The thermo cycle condition of PCR include 10 min at 95°C; followed by 45 cycles of 15 s at 95°C, 20 s at 58°C, and 20 s at 72°C. The Alu amplicon was conducted by Alu primer and probe (sense: GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA and antisense: ATTAACTAAACTAATCTTAAACTCCTAACCTCA, and FAM labeled probe: CCTACCTTAACCTCCC) in a 20 μl reaction volume with 200 mM deoxynucleotides, 0.3 mM forward and reverse PCR primers, 0.1 mm probe using the following PCR program: 95°C for 5 min, then 45 cycles of 95°C for 15 s followed by 60°C for 1 min.[16] The methylated NID2 DNA from H1299 cell line were gradient diluted as a standard curve to quantify NID2 and Alu production. Each q-MSP reaction was performed in triplicate, and the data were analyzed using the 2ΔCt approach.

F1-13
Figure 1:
Nidogen 2 shows hypermethylation in nonsmall cell lung cancer, especially in advanced stages of the disease. (a) The schematic representation of the nidogen 2 gene loci on the chromosome and the CpG island in its promoter, along with the quantitative methylation specific polymerase chain reaction primer locations, are shown. (b) Methylation level analysis of nidogen 2 in 96 cases of nonsmall cell lung cancer and 18 cases of noncancerous lung lesions. (c) Nidogen 2 is Hypermethylation in nonsmall cell lung cancer in its advanced stage (T3 + T4)

Statistical analysis

Data were presented as the means ± standard deviation. Statistical analysis was done using SPSS 13.0. (SPSS Inc., Chicago, IL, USA). Receiver operating characteristic curve (ROC) and area under the curve (AUC) analysis were performed to evaluate the sensitivity and specificity of NID2 methylation in NSCLC prediction. Chi-square and Fisher's exact test were applied to evaluate the relationship between DNA methylation and clinicopathological characteristics. P < 0.05 were considered statistically significant.

RESULTS

To further explore the significance of NID2 DNA methylation in NSCLC development, we performed q-MSP on three different clinical samples categories: Tissue, BAL, and plasma. For tissues, we collected 96 cases of NSCLC, with 18 cases of NCLL as control; for BAL, 46 cases of NSCLC, with 12 NCLL as control; for plasma, 46 NSCLC, with 30 NCLL as control. The 46 cases of NSCLC for BAL and plasma were same panel patients from 96 cases of NSCLC.

DNA methylation frequency of nidogen 2 in nonsmall cell lung cancer tissue

The methylation status in the promoter region of NID2 was investigated by q-MSP. The results showed that hypermethylated NID2 gene in 57 cases out of 96 NSCLC (59.38%), compared with that the hypermethylated NID2 gene in 3 cases out of 18 cases NCLL (16.67%), a significant difference between tumor and control (P = 0.0001) [Table 2 and Figure 1b]. Meanwhile, we also evaluated the association between NID2 methylation and clinical pathological characteristics, including age, gender, histological subtype, and staging (data not shown). Subsequently, NID2 methylation correlated with clinical staging was revealed: Increased NID2 methylation in an advanced stage of NSCLC than in early stage [Figure 1c].

T2-13
Table 2:
The diagnosis performance of different panels of genes using patients with noncancerous lung lesions as controls

Comparison of nidogen 2 methylation status in 3 different sample types: Tissue, bronchoalveolar lavage, and plasma

To explore the implication of NID2 methylation in different samples, we performed the q-MSP and ROC analysis in three different sample types: Tissue, BAL, and plasma, all the NSCLC sample coming from same panel of 46 NSCLC patients. The results showed: In the analysis of NID2 methylation in lung tissue, increased NID2 methylation rate was found in NSCLC tissue than that in NCLL. (NSCLC 30/46, 65.22%; against NCLL 3/18, 16.67%); ROC analysis revealed that AUC = 0.737, P = 0.0042 [Figure 2a]. In terms of NID2 DNA methylation analysis in BAL, no statistically different NID2 methylation rate was found between NSCLC and NCLL. (NSCLC 14/46, 30.43%; against NCLL 2/12, 16.67%); ROC analysis revealed that AUC = 0.632, P = 0.1612 [Figure 2b]. As the NID2 DNA methylation analysis in plasma was concerned, higher NID2 methylation rate was revealed in NSCLC than that in NCLL (NSCLC 21/46, 45.65%; 6/30, 20.0%), with ROC analysis AUC = 0.671, P = 0.0187 [Figure 2c]. The results from above suggest the NID2 methylation status in tumor tissue or peripheral blood might hold potential for NSCLC identification.

F2-13
Figure 2:
Nidogen 2 methylation level in 46 nonsmall cell lung cancer patients with three different types of samples. (a) Methylation level of nidogen 2 in 46 nonsmall cell lung cancer patients and 18 cases of noncancerous lung lesions in Tissue. (b) Methylation level of nidogen 2 in 46 nonsmall cell lung cancer patients and 12 cases of noncancerous lung lesions in bronchoalveolar lavage. (c) Methylation level of nidogen 2 in 46 nonsmall cell lung cancer patients and 30 cases of noncancerous lung lesions in plasma

DNA methylation of nidogen 2 in plasma is superior to that in bronchoalveolar lavage in predicating nonsmall cell lung cancer

To research the possible relationship of NID2 methylation in the three different sample types, we evaluated the NID2 methylation status of these sample types within the same NSCLC patient groups (46 in total). For tissue analysis, we found 30 cases hypermethylation in all the 46 NSCLC. For 46 BAL analysis, 14 cases hypermethylation were identified in all 46 NSCLC; in which 8 cases were overlapped with the methylation in tissue samples, making the positive coincidence rate 57.14% (8/14) and the NSCLC detection rate 26.67% (8/30). For 46 plasma analysis, 21 cases hypermethylation were uncovered in all the 46 NSCLC; in which 16 cases were identical to the methylation in tissue samples, making the positive coincidence rate 76.19% (16/21), and the NSCLC detection rate 53.33% (16/30) [Figure 3a and b]. Put together, NID2 methylation in plasma is more potential than that in BAL to diagnosis the NSCLC process.

F3-13
Figure 3:
Nidogen 2 methylation detection in plasma is better than that in bronchoalveolar lavage. (a) In 46 nonsmall cell lung cancer patients, the nidogen 2 methylation status were analyzed in three various samples types, and their methylation coincidence and nonsmall cell lung cancer detection rates are shown (black square represent nidogen 2 methylation, white square represent nidogen 2 methylation). (b) Venn diagram of the hypermethylation differentially cases that occurred in the tissue, plasma, and bronchoalveolar lavage

DISCUSSION

NID2, a member of nidogen protein family, could constitute the extracellular matrix, namely the basement membrane, with collagen IV and laminins.[17] The tripolymer thus formed by NID2, collagen IV, and laminins, could link and stabilize the three dimension structure of basement membrane.[18] NID2 protein also cooperates with cell surface receptors in controlling cell differentiation, migration, and invasion process.[19202122] So far, down-regulation of the gene expression and aberrant methylation in the promoter region of NID2 has been observed in multiple malignant tumors, including colon cancer, hepatocellular carcinoma, bladder cancer, and oral cavity squamous cell carcinoma.[23242526]

In this study, we found NID2 hypermethylation in tumor tissue in stage I of NSCLC patients,[14] which hold the potential as a biomarker for a malignant tumor. However, this tissue-based detection can be only performed from postoperative or biopsy samples, both belongs to invasive detections procedures; noninvasive, or minor-invasive sample access based detection is the future tendency for clinical malignant tumor test. BAL, a lung-origin specific resource sample, can be accessible during the bronchoscopy examine procedure; collective studies have been documented on the aberrant DNA methylation in NSCLC, but with incongruous results.[2728293031323334] Increased circulating DNA in cancer patients have long been observed;[35] multiple researches has been performed in tumor study, lung cancer included.[36373839] Being a remote medium, circulating DNA might be specific to a particular tissue, but it holds the advantages of detection in easy access to the early screening procedures. In this study, we aim to found the consistent NID2 methylation target in BAL and plasma which can be used for the NSCLC detection in minor-invasive samples.

In this study, we conducted q-MSP in tissue DNA from 96 NSCLC patients and 18 NCLL and revealed the obvious hypermethylation status of NID2 (59.38% vs. 16.67%, P = 0.0001), a consistent results with our previous study. We have evaluated the NID2 methylation status in BAL and blood, and found that NID2 methylation rate is obviously lower in BAL (30.43%) than that in tissue, and without difference with that in NCLL (P = 0.6715). We presumed that this phenomenon might be related to the specific location of the lung tumor, the chance to collect tumor cells by performing bronchoscopy examination is much smaller in peripheral type of lung cancer than that in the central type. In contrast, we observed positive results in plasma analysis in that NID2 methylation in NSCLC plasma is different to that in NCLL plasma (P = 0.0199), though the 50.0% sensitivity of plasma methylation rate is lower than that in tissue. We also found that more patients who belonging to the middle stage or later stage were identified by NID2 methylation in plasma (data not shown). This might result from the different quantity of exfoliated cells entered the blood stream with a different stage of NSCLC patients. This phenomenon also remind more sensitive detection measures be taken, such as those used by Fackler et al.[40] We are to apply this method in an expended samples in future.

CONCLUSIONS

This study have confirmed the aberrant NID2 methylation in NSCLC tissue, and the extended work with BAL and peripheral plasma established that plasma cf-DNA is more suitable than BAL as a sample to detect NID2 methylation to predict NSCLC, which hold the potential as a biomarker to early diagnosis, high-risk population screening of NSCLC.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

Acknowledgments

We are grateful to the Surgery Department of The First Affiliated Hospital of Guangxi Medical University for providing valuable samples and clinical information. The authors would like to acknowledge the following funding source: Guangxi Science and Technology Research Foundation (grants 1355005-3-19, Xu Feng).

REFERENCES

1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics CA Cancer J Clin. 2011;61:69–90
2. Zhou XN. Lung cancer epidemiology in China Chin J Cancer Prev Treat. 2007;14:881–3
3. Molina JR, Yang P, Cassivi SD, Schild SE, Adjei AA. Non-small cell lung cancer: Epidemiology, risk factors, treatment, and survivorship Mayo Clin Proc. 2008;83:584–94
4. Risch A, Plass C. Lung cancer epigenetics and genetics Int J Cancer. 2008;123:1–7
5. Leaf C. Why we're losing the war on cancer (and how to win it) Fortune. 2004;149:76–82 84-6, 88
6. Jones PA, Baylin SB. The epigenomics of cancer Cell. 2007;128:683–92
7. Laird PW. The power and the promise of DNA methylation markers Nat Rev Cancer. 2003;3:253–66
8. Hoque MO, Begum S, Topaloglu O, Chatterjee A, Rosenbaum E, Van Criekinge W, et al Quantitation of promoter methylation of multiple genes in urine DNA and bladder cancer detection J Natl Cancer Inst. 2006;98:996–1004
9. Zhao Y, Zhou H, Ma K, Sun J, Feng X, Geng J, et al Abnormal methylation of seven genes and their associations with clinical characteristics in early stage non-small cell lung cancer Oncol Lett. 2013;5:1211–8
10. Ibanez de Caceres I, Dulaimi E, Hoffman AM, Al-Saleem T, Uzzo RG, Cairns P. Identification of novel target genes by an epigenetic reactivation screen of renal cancer Cancer Res. 2006;66:5021–8
11. Zhao Y, Xue F, Sun J, Guo S, Zhang H, Qiu B, et al Genome-wide methylation profiling of the different stages of hepatitis B virus-related hepatocellular carcinoma development in plasma cell-free DNA reveals potential biomarkers for early detection and high-risk monitoring of hepatocellular carcinoma Clin Epigenetics. 2014;6:30
12. Yu J, Zhu T, Wang Z, Zhang H, Qian Z, Xu H, et al A novel set of DNA methylation markers in urine sediments for sensitive/specific detection of bladder cancer Clin Cancer Res. 2007;13:7296–304
13. Machida EO, Brock MV, Hooker CM, Nakayama J, Ishida A, Amano J, et al Hypermethylation of ASC/TMS1 is a sputum marker for late-stage lung cancer Cancer Res. 2006;66:6210–8
14. Geng J, Sun J, Lin Q, Gu J, Zhao Y, Zhang H, et al Methylation status of NEUROG2 and NID2 improves the diagnosis of stage I NSCLC Oncol Lett. 2012;3:901–6
15. Goldstraw P, Crowley J, Chansky K, Giroux DJ, Groome PA, Rami-Porta R, et al The IASLC Lung Cancer Staging Project: Proposals for the revision of the TNM stage groupings in the forthcoming (seventh) edition of the TNM classification of malignant tumours J Thorac Oncol. 2007;2:706–14
16. Weisenberger DJ, Campan M, Long TI, Kim M, Woods C, Fiala E, et al Analysis of repetitive element DNA methylation by MethyLight Nucleic Acids Res. 2005;33:6823–36
17. Ulazzi L, Sabbioni S, Miotto E, Veronese A, Angusti A, Gafà R, et al Nidogen 1 and 2 gene promoters are aberrantly methylated in human gastrointestinal cancer Mol Cancer. 2007;6:17
18. Timpl R, Brown JC. Supramolecular assembly of basement membranes Bioessays. 1996;18:123–32
19. Dong LJ, Hsieh JC, Chung AE. Two distinct cell attachment sites in entactin are revealed by amino acid substitutions and deletion of the RGD sequence in the cysteine-rich epidermal growth factor repeat 2 J Biol Chem. 1995;270:15838–43
20. Dedhar S, Jewell K, Rojiani M, Gray V. The receptor for the basement membrane glycoprotein entactin is the integrin alpha 3/beta 1 J Biol Chem. 1992;267:18908–14
21. Yi XY, Wayner EA, Kim Y, Fish AJ. Adhesion of cultured human kidney mesangial cells to native entactin: Role of integrin receptors Cell Adhes Commun. 1998;5:237–48
22. Wu C, Chung AE, McDonald JA. A novel role for alpha 3 beta 1 integrins in extracellular matrix assembly J Cell Sci. 1995;108:2511–23
23. Cheng ZX, Huang XH, Wang Q, Chen JS, Zhang LJ, Chen XL. Clinical significance of decreased nidogen-2 expression in the tumor tissue and serum of patients with hepatocellular carcinoma J Surg Oncol. 2012;105:71–80
24. Maldonado L, Brait M, Michailidi C, Munari E, Driscoll T, Schultz L, et al An epigenetic marker panel for recurrence risk prediction of low grade papillary urothelial cell carcinoma (LGPUCC) and its potential use for surveillance after transurethral resection using urine Oncotarget. 2014;5:5218–33
25. Kim JC, Lee HC, Cho DH, Choi EY, Cho YK, Ha YJ, et al Genome-wide identification of possible methylation markers chemosensitive to targeted regimens in colorectal cancers J Cancer Res Clin Oncol. 2011;137:1571–80
26. Guerrero-Preston R, Soudry E, Acero J, Orera M, Moreno-López L, Macía-Colón G, et al NID2 and HOXA9 promoter hypermethylation as biomarkers for prevention and early detection in oral cavity squamous cell carcinoma tissues and saliva Cancer Prev Res (Phila). 2011;4:1061–72
27. Kim H, Kwon YM, Kim JS, Lee H, Park JH, Shim YM, et al Tumor-specific methylation in bronchial lavage for the early detection of non-small-cell lung cancer J Clin Oncol. 2004;22:2363–70
28. Topaloglu O, Hoque MO, Tokumaru Y, Lee J, Ratovitski E, Sidransky D, et al Detection of promoter hypermethylation of multiple genes in the tumor and bronchoalveolar lavage of patients with lung cancer Clin Cancer Res. 2004;10:2284–8
29. Chan EC, Lam SY, Tsang KW, Lam B, Ho JC, Fu KH, et al Aberrant promoter methylation in Chinese patients with non-small cell lung cancer: Patterns in primary tumors and potential diagnostic application in bronchoalevolar lavage Clin Cancer Res. 2002;8:3741–6
30. Guo M, House MG, Hooker C, Han Y, Heath E, Gabrielson E, et al Promoter hypermethylation of resected bronchial margins: A field defect of changes? Clin Cancer Res. 2004;10:5131–6
31. De Fraipont F, Moro-Sibilot D, Michelland S, Brambilla E, Brambilla C, Favrot MC. Promoter methylation of genes in bronchial lavages: A marker for early diagnosis of primary and relapsing non-small cell lung cancer? Lung Cancer. 2005;50:199–209
32. Grote HJ, Schmiemann V, Geddert H, Bocking A, Kappes R, Gabbert HE, et al Methylation of RAS association domain family protein 1A as a biomarker of lung cancer Cancer. 2006;108:129–34
33. Grote HJ, Schmiemann V, Geddert H, Rohr UP, Kappes R, Gabbert HE, et al Aberrant promoter methylation of p16(INK4a), RARB2 and SEMA3B in bronchial aspirates from patients with suspected lung cancer Int J Cancer. 2005;116:720–5
34. Schmiemann V, Böcking A, Kazimirek M, Onofre AS, Gabbert HE, Kappes R, et al Methylation assay for the diagnosis of lung cancer on bronchial aspirates: A cohort study Clin Cancer Res. 2005;11:7728–34
35. Shapiro B, Chakrabarty M, Cohn EM, Leon SA. Determination of circulating DNA levels in patients with benign or malignant gastrointestinal disease Cancer. 1983;51:2116–20
36. Usadel H, Brabender J, Danenberg KD, Jerónimo C, Harden S, Engles J, et al Quantitative adenomatous polyposis coli promoter methylation analysis in tumor tissue, serum, and plasma DNA of patients with lung cancer Cancer Res. 2002;62:371–5
37. Ulivi P, Zoli W, Calistri D, Fabbri F, Tesei A, Rosetti M, et al p16INK4A and CDH13 hypermethylation in tumor and serum of non-small cell lung cancer patients J Cell Physiol. 2006;206:611–5
38. Esteller M, Sanchez-Cespedes M, Rosell R, Sidransky D, Baylin SB, Herman JG. Detection of aberrant promoter hypermethylation of tumor suppressor genes in serum DNA from non-small cell lung cancer patients Cancer Res. 1999;59:67–70
39. Bearzatto A, Conte D, Frattini M, Zaffaroni N, Andriani F, Balestra D, et al p16(INK4A) Hypermethylation detected by fluorescent methylation-specific PCR in plasmas from non-small cell lung cancer Clin Cancer Res. 2002;8:3782–7
40. Fackler MJ, Lopez Bujanda Z, Umbricht C, Teo WW, Cho S, Zhang Z, et al Novel methylated biomarkers and a robust assay to detect circulating tumor DNA in metastatic breast cancer Cancer Res. 2014;74:2160–70
Keywords:

Bronchoalveolar lavage; DNA methylation; nidogen 2; nonsmall cell lung cancer; plasma; quantitative methylation specific polymerase chain reaction

© 2018 Journal of Cancer Research and Therapeutics | Published by Wolters Kluwer – Medknow