BopA Does Not Have a Major Role in the Adhesion of Bifidobacterium bifidum to Intestinal Epithelial Cells, Extracellular Matrix Proteins, and Mucus

Bifidobacterium bifidum type strain (DSM20456) and Bifidobacterium bifidum MIMBb75 (from the Industrial Microbiology Culture Collection DiSTAM, University of Milan, Milan, Italy) were cultivated in De Man, Rogosa, and Sharpe broth (MRS; Difco) supplemented with 500 μg ml⁻¹ l-cysteine (Sigma-Aldrich) and were incubated at 37°C in an anaerobic chamber.

Chromosomal DNA of B. bifidum DSM20456 was extracted by using a Wizard genomic DNA purification kit (Promega) according to the manufacturer′s instructions after mechanical lysis of bacterial cells by bead beating with zirconium beads (diameter, 0.1 mm) 3 times for 60 s each. The bopA gene, without the regions encoding the signal sequence and lipobox, was obtained by amplifying the chromosomal DNA of B. bifidum DSM20456 with a primer pair, one containing the NcoI site (5′AATTACCATGGGCAACAACGGCGC3′) and another containing the HindIII site (5′TAATTAAGCTTCTTCTCCCAGCCGAG3′) (designed on the basis of the available bopA sequence of B. bifidum MIMBb75). The gene encoding BopA was cloned into the vector pET28b+ (Novagen) for expression as a C-terminal His₆ fusion protein in E. coli strain BL21(DE3)(pLysS). The BopA protein was purified from the cytoplasm of E. coli under native conditions using the Qiaexpress protein purification system (Qiagen) according to the manufacturer′s instructions.

The immunization protocol described by Johnston et al. (18) was used to raise polyclonal rabbit antibodies against His₆-BopA of B. bifidum DSM20456 (Laboratory Animal Centre of University of Helsinki). Briefly, a 1:1 mixture of 400 ng of the purified recombinant His₆-BopA and Freund′s complete adjuvant was administered by subcutaneous injection. Preimmunization serum was collected before the primary immunization. The initial injection was followed by 3 consecutive booster injections at 3-week intervals with 1:1 mixtures of 200 ng of the His₆-BopA and Freund's incomplete adjuvant. Blood was collected 10 days after the last booster injection, and antiserum was prepared according to standard protocols (19).

Immunogold-labeled thin sections of B. bifidum DSM20456 and MIMBb75 were prepared for studying the localization of BopA on the surface of B. bifidum strains by immunoelectron microscopy (IEM) using anti-BopA antiserum or preimmune serum as described previously (20). Briefly, bacteria were cultivated, washed, and fixed prior to being embedded in Lowicryl HM20 resin. After polymerization, ultrathin sections were cut and collected on carbon-coated nickel grids. Sections were blocked (1% bovine serum albumin [BSA; Sigma-Aldrich], 0.5% fish skin gelatin [FSG; Sigma-Aldrich], and 1% fetal calf serum [FCS; Integro BV] in sodium phosphate buffer) and incubated with anti-BopA antiserum or preimmune serum (both diluted 1:100 in sodium phosphate buffer containing 2% BSA, 0.1% Tween 20, and 0.1% FSG) for 2.5 h at room temperature. Grids were then washed five times (0.2% BSA, 0.01% Tween 20, and 0.01% FSG in sodium phosphate buffer) and incubated on drops of 1:80-diluted protein A conjugated to gold particles (10 nm) for 20 min. After extensive washing in phosphate buffer and distilled water, the sections were poststained in uranyl acetate and lead citrate before examination in a JEOL EXII transmission electron microscope.

The immunofluorescence staining was used to confirm the presence of BopA on the surface of B. bifidum as detailed previously (21). Briefly, B. bifidum cells were cultivated, washed with phosphate-buffered saline (PBS), and fixed with 3.5% (wt/vol) paraformaldehyde in PBS prior labeling with anti-BopA antiserum or preimmune serum as the primary antiserum and Alexa-488 (Invitrogen)-conjugated anti-rabbit IgG (1 μg ml⁻¹) as the secondary antibody. Bacteria were then examined with an epifluorescence microscope (Leica DM 4000B) equipped with a filter for the Alexa-488 label (excitation, 450 to 490 nm; emission, 515 nm), and images were digitally recorded using CellP̂ imaging software for life sciences microscopy (Soft Imaging System GmbH).

Cell wall-associated proteins of B. bifidum strains DSM20456 and MIMBb75 were isolated as described by Kankainen et al. (3). When the presence of BopA in the cell wall was analyzed, the isolated proteins were separated in 12% (wt/vol) SDS-PAGE and transferred onto 0.2-μm Immobilon-P polyvinylidene difluoride (PVDF) membranes (Millipore) for Western blotting with anti-BopA antiserum and horseradish peroxidase-conjugated anti-rabbit IgG (Bio-Rad). The protein was then detected by using an enhanced chemiluminescence (ECL) Advance Western blotting detection kit (Amersham) according to the manufacturer′s instructions.

The human intestinal cell lines Caco-2 and HT-29 were obtained from DSMZ and were grown at 37°C in a 95% air–5% CO₂ atmosphere. Caco-2 cells were grown in RPMI 1640 medium (Sigma-Aldrich) supplemented with 2 mM l-glutamine (Lonza), 20% heat-inactivated (30 min at 56°C) fetal calf serum, 100 U ml⁻¹ penicillin-streptomycin (Lonza), and 1% (vol/vol) nonessential amino acids (Lonza), and HT-29 cells were grown in McCoy 5A medium (Lonza) supplemented with 10% fetal calf serum and 100 U ml⁻¹ penicillin-streptomycin.

Human colonic mucus was isolated from a healthy piece of tissue obtained from patients with colorectal cancer. The mucus layer was collected as previously described (22). In short, resected material was collected on ice within 20 min and processed immediately by washing gently with PBS containing 0.01% gelatin. The mucus was collected into a small amount of HEPES-Hanks buffer by gently scraping with a rubber spatula, centrifuged (13,000 × g, 10 min) and stored at −20°C until further use. In the adhesion assays, mucus preparations from several individuals were pooled in equal ratios, the pooled mucus preparation was diluted to a protein concentration of 0.5 mg ml⁻¹ with HEPES-Hanks, and 100 μl of this solution was immobilized passively on Maxisorp microtiter plate wells (Nunc) by overnight incubation at 4°C. The use of human intestinal mucus for the adhesion studies was approved by the ethical committee of the Hospital District of Southwest Finland, and written informed consent was obtained from all patients from whom mucus was collected.

For the adhesion tests Caco-2 and HT-29 cells were cultivated on 96-well tissue culture plate (10,000 cells well⁻¹; Nunc) for 3, 8, and 21 days. The cells were washed twice with culture medium before the adhesion assay. Laminin (Sigma-Aldrich), collagen I (Sigma-Aldrich), collagen IV (Sigma-Aldrich), fibronectin (Calbiochem), fetuin (Sigma-Aldrich), and BSA (Sigma-Aldrich) were immobilized on Maxisorp microtiter wells at a concentration of 2.5 pmol well⁻¹ (23). The wells containing immobilized mucus or ECM proteins were washed twice with PBS and incubated with blocking buffer (0.5% [wt/vol] BSA in PBS) for 1 h at room temperature. The wells were washed again three times with PBS prior to the addition of bacteria. B. bifidum DSM20456 and MIMBb75 were metabolically radiolabeled by cultivating bacteria with 10 μl ml⁻¹ [5′-³H]thymidine (17.0 Ci/mmol; PerkinElmer). The adhesion assay was performed as described previously by Vesterlund et al. (22) with the following modifications. After cultivation, bacteria were collected by centrifugation and washed with RPMI 1640 without supplements (adhesion to Caco-2 cells), McCoy 5A without supplements (adhesion to HT-29 cells), or PBS (adhesion to mucus and ECM proteins). The optical density was adjusted (A₆₀₀ = 0.25) to the same culture medium or buffer used for washing. Bacteria (100 μl) were incubated on mucus or ECM proteins at 37°C or on the epithelial cells in a CO₂ incubator at 37°C for 1 h, and the nonadherent bacteria were removed by washing the wells three times with PBS. Bacteria bound to cells, mucus, or ECM proteins were lysed with 1% SDS–0.1 M NaOH by incubating at 60°C for 1 h. The radioactivity of the suspension was measured by liquid scintillation. Four to five parallel wells (i.e., technical replicates) were used in each experiment, and all experiments were repeated two to seven times. The percent bacterial adhesion was determined by calculating the ratio between the radioactivity of the adherent bacteria and that of the added bacteria. In the inhibition assays, bacteria were preincubated with anti-BopA antiserum or preimmune serum diluted 1:100 in culture medium or PBS prior to addition of bacteria to the cells, mucus, or ECM proteins. In competition assays, Caco-2 and HT-29 cells were incubated with His₆-BopA (100 μg well⁻¹) in a CO₂ incubator at 37°C for 1 h prior to the adhesion assay with bacteria.

Recombinant BopA was radiolabeled (¹²⁵I), and the binding assays to mucus and ECM proteins were performed essentially as detailed by Kankainen et al. (3). Mucus and ECM proteins were immobilized on Maxisorp microtiter wells and blocked with BSA as described above. Caco-2 and HT-29 cells were cultivated on 96-well microtiter plates for 3, 8, and 21 days and washed twice with culture medium without supplements. The ¹²⁵I-labeled BopA (50 pmol) was added to the wells and incubated for 1 h at 37°C in a CO₂ incubator. The wells were then washed three times with PBS to remove any loosely bound protein, treated with 1% SDS–0.1 M NaOH, and incubated at 60°C for 1 h. The radioactivity of bound ¹²⁵I-BopA was measured in a Wallac 1480 Wizard-3 automatic gamma counter. Four to six parallel wells (i.e., technical replicates) were used in each protein binding experiment, and all experiments were repeated two to four times.

A pairwise Student′s t test was used to determine the significant difference (P < 0.05) between the samples and controls. Results shown in Fig. 3, 4, and 5 are the means ± standard deviations for technical replicates (parallel wells) from representative experiments.

The gene coding for B. bifidum DSM20456 lipoprotein BopA missing the signal sequence and lipobox (i.e., the recognition signal for lipid modification by thioacylation) was cloned into an expression vector. The bopA sequence of B. bifidum MIMBb75 was available from the previous studies (9), and it was utilized in designing the primers used for the amplification of bopA gene of B. bifidum DSM20456. The gene was then sequenced, and the obtained DNA sequence was identical to that of bopA of B. bifidum MIMBb75 (9). The BopA was expressed as a His₆ fusion in E. coli under native conditions and purified by nickel-nitrilotriacetic acid (Ni-NTA) affinity chromatography. The purified protein was analyzed by SDS-PAGE and Western blotting (Fig. 1). The fusion protein showed an expected apparent molecular size of 61 kDa (Fig. 1A), and no other peptides were detected in the SDS-PAGE, indicating a high purity of the protein. Next, antiserum against His₆-BopA was produced, and its reactivity was tested by Western blotting. The hyperimmune serum against BopA reacted well with the recombinant protein (Fig. 1B), whereas the preimmune serum failed to recognize it (Fig. 1B).

Three different methods were used to study the cellular localization of BopA in B. bifidum DSM20456 and MIMBb75. First, BopA was visualized in thin-sectioned B. bifidum cells by IEM using antiserum produced against His₆-BopA in a combination with the protein A conjugated to 10-nm gold particles. IEM revealed that the majority of BopA is within or in close proximity to the cell wall, whereas preimmune serum failed to detect BopA in the thin sections (Fig. 2A). Second, the surface localization of BopA was verified in B. bifidum DSM20456 and MIMBb75 cells by indirect immunofluorescence staining (Fig. 2B). BopA was present on the cell surfaces of both strains (Fig. 2B), but the staining was not evenly distributed around the cells, suggesting a localized distribution of BopA on the cell surface. The preimmune serum did not give any signal with B. bifidum cells in immunofluorescent staining (Fig. 2B). Third, the cell envelopes were extracted from B. bifidum DSM20456 as well as MIMBb75, and BopA was detected among the cell surface-associated proteins by Western blotting using the anti-BopA antiserum. The antiserum recognized the native, cell envelope-associated BopA, and the amount of BopA in the cell surface extracts was found to be comparable in the two strains (Fig. 2C). In conclusion, BopA was shown to be abundantly present in the cell envelopes of both studied strains of B. bifidum.

The adherence of B. bifidum DSM20456 and MIMBb75 as well as the binding of recombinant BopA protein to the epithelial cells of different ages was tested. Caco-2 cells differentiate in 14 days after confluence, and the adhesion and binding properties were tested with undifferentiated cells (3 days) in addition to cells at two differentiation stages (8 and 21 days). The number of added cells (10,000 cells well⁻¹) resulted in confluence in 3 days; i.e., at all growth times, the cell cultures were confluent. For comparison, the same growth times were used for HT-29 cell line. Both strains, B. bifidum DSM20456 and MIMBb75, were found to adhere well to Caco-2 and HT-29 cells. The adhesion was most efficient (12 to 23%) with 8-day-old epithelial cells and the weakest (5 to 11%) with 21-day-old cells (Fig. 3A). The binding of ¹²⁵I-labeled His₆-BopA to 3- and 8-day-old Caco-2 and 8- and 21-day-old HT-29 cells was found to be statistically significantly (P < 0.05) higher than the background level binding of ¹²⁵I-BSA (Fig. 3B). However, the moderate level of His₆-BopA binding (maximum, 2.5 times greater than the background binding level of BSA) and the relatively high adhesion (up to 23% adherence) of B. bifidum to the epithelial cells indicated that BopA may not have a major role in mediating bifidobacterial adhesion to Caco-2 and HT-29 cells. To readdress the role of BopA as an adhesin, we tested the inhibition of bacterial adhesion to epithelial cell lines in the presence of anti-BopA antiserum, preimmune serum, and purified His₆-BopA. In the inhibition assays, where bacterial cells were pretreated with the antiserum (diluted 1:100) prior to addition of bacteria to the cells, no significant reduction in the bacterial adherence was observed (Fig. 3A). As an exception, the adherence of B. bifidum MIMBb75 to 3-day-old Caco-2 cells was significantly diminished upon pretreatment with anti-BopA antiserum. However, the preimmune serum also inhibited adhesion, indicating a BopA-independent inhibitory effect of the antiserum in the binding assay (Fig. 3A). The results were not affected when the serum was used at higher concentrations (diluted 1:50 and 1:10) (data not shown). In the competition assays, the epithelial cells were first incubated with an extremely large amount (1 mg ml⁻¹) of recombinant BopA prior to the bacterial adherence. Similarly to the inhibition assays, no significant reduction was observed in the adherence of B. bifidum to epithelial cells of different ages in the competition assay, with the exception of the diminished adherence of MIMBb75 to 3-day-old Caco-2 cells in the competition with His₆-BopA (Fig. 3A). A slight variation in the adhesion levels as well as in the inhibition of the adhesion with the addition of anti-BopA antiserum or His₆-BopA was seen between the experiments. Figure 3 shows that B. bifidum DSM20456 and MIMBb75 are highly adherent to epithelial cells (5 to 25% of added bacteria adhered) and that in general the adhesion could not be inhibited with the pretreatment of bacterial cells by anti-BopA antiserum or outcompeted with the addition of recombinant BopA protein.

B. bifidum strains DSM20456 and MIMBb75 were found to be adherent to mucus (Fig. 4A), and the recombinant His₆-BopA was found to bind moderately to human colonic mucus (Fig. 4B). To study the role of BopA in mediating the adhesion of B. bifidum to mucus, the anti-BopA antiserum was used to inhibit the bacterial adhesion, and preimmune serum was used as a control. A minor decrease was seen in the adhesion when bacterial cells were pretreated with the anti-BopA antiserum, but the decrease was not statistically significant. These results suggest that BopA has only a minor role, if any, in the adherence of B. bifidum to human colonic mucus.

The adherence of B. bifidum DSM20456 and MIMBb75 cells and the binding of His₆-BopA to ECM proteins laminin, collagen I, collagen IV, fibronectin, and fetuin (highly glycosylated protein) were studied. Both strains of B. bifidum showed adhesiveness to fibronectin, and B. bifidum MIMBb75 also adhered to laminin (Fig. 5A). Based on these results, we selected laminin and fibronectin for the inhibition experiments. The bacteria were incubated with anti-BopA antiserum or preimmune serum before being added to the immobilized ECM proteins. Significant inhibition in the adhesion of both strains of B. bifidum to fibronectin was detected (Fig. 5B and C), whereas antiserum did not affect the adherence to laminin (Fig. 5C). However, since the preimmune serum caused a similar reduction in bacterial adhesion, these results suggest an unspecific effect, rather than a specific BopA-dependent inhibition, brought about by the anti-BopA antiserum. This was further supported by the results of His₆-BopA binding to ECM proteins, as recombinant BopA showed moderate binding to laminin, whereas it failed to bind fibronectin (Fig. 5D).