Research Article
1 July 2009

Rapid and Sensitive Detection of Shiga Toxin-Producing Escherichia coli from Nonenriched Stool Specimens by Real-Time PCR in Comparison to Enzyme Immunoassay and Culture

ABSTRACT

Shiga toxin (Stx)-producing Escherichia coli (STEC) bacteria are a frequent cause of food-borne gastroenteritis, hemorrhagic colitis, and hemolytic uremic syndrome. Because antimicrobial agents are generally contraindicated in patients infected with STEC, a sensitive and specific diagnostic test with rapid turnaround is essential. Current culture methods may fail to detect non-O157 STEC. We evaluated a Stx gene real-time PCR assay using hybridization probes and the LightCycler instrument with 204 prospectively collected stool specimens, which were also tested for Stx by enzyme immunoassay (EIA) (ProSpecT STEC; Remel, Lenexa, KS) and by culturing on chromogenic agar (Chromagar O157; BD BBL, Sparks, MD). In addition, 85 archived stool specimens previously tested for Stx (by EIA) and/or E. coli O157:H7 (by culture) were tested by PCR. Sample preparation for PCR included mixing the stool in sterile water and extraction of nucleic acid using the MagNA Pure LC instrument (Roche Diagnostics). The PCR assay had 100% sensitivity and specificity compared to EIA and culture for specimens collected prospectively (4 of 204 specimens were positive) and compared to culture and/or EIA for archival specimens (42 of 85 specimens were positive). Both the EIA and PCR produced positive results from a specimen containing an O103 serotype STEC in the prospective specimens, and the PCR test detected three positive specimens that contained nonviable STEC in the archived specimens. The PCR assay demonstrated 100% sensitivity and specificity compared to EIA and/or culture and more rapid turnaround than either EIA or culture.
Shiga toxin (Stx)-producing Escherichia coli (STEC) is a frequent cause of food-borne outbreaks of diarrhea (15). Disease caused by STEC is characterized by abdominal pain and bloody diarrhea, and 5 to 15% of those individuals infected with serotype O157:H7 develop hemolytic uremic syndrome (HUS), a potentially life-threatening condition consisting of hemolytic anemia, thrombocytopenia, and kidney failure caused primarily by Stx (8). STEC may carry genes for one or both types of Stx, Stx1 and Stx2 (17).
Although STEC strains are a diverse group of pathogens, up to the present, the most common serotype in the United States has been O157:H7. A common association is that of E. coli O157:H7 contaminating ground beef (3, 7), but recent large outbreaks have involved a variety of other foods, including leafy greens (6, 29). The diversity of potentially contaminated food means that patients may acquire STEC infection from many foodstuffs, far beyond the stereotypical risk of undercooked ground beef. The common denominator of tainted food products seems to be direct or indirect contamination from bovine feces. To best detect infected patients and potential outbreaks, clinical laboratories must have tools to quickly and accurately detect STEC in stool specimens. Culture on sorbitol MacConkey agar is an inexpensive, effective, and widely used method based on lack of sorbitol fermentation by E. coli O157:H7. Several drawbacks limit the utility of culture, including slow turnaround, false-negative results in antibiotic-treated patients, and false-negative results due to emerging serotypes of non-O157 STEC that ferment sorbitol (1, 14, 16, 29). Alternatively, a method that is increasingly utilized is detection of Stx antigen from stool, either directly or after broth enrichment. Our experience concurs with enzyme immunoassay (EIA) product insert data that optimal sensitivity and specificity are achieved only when a broth enrichment step is employed; this results in slow turnaround.
Here, we describe a real-time PCR assay that can detect STEC using nucleic acid extracts of stool specimens. We evaluated the performance of this assay using both archived stool specimens and prospectively collected specimens and compared the results to those of culture and Stx antigen detection.
(This study was presented in part at the 48th Annual Interscience Conference on Antimicrobial Agents and Chemotherapy, Washington, DC, 25 to 28 October 2008.)

MATERIALS AND METHODS

PCR assay.

The PCR assay detects both the stx1 and stx2 genes by using primers designed for each of the genes. The master mixture (15 μl) containing 1× Roche LC FastStart DNA Master HybProbe (Taq DNA polymerase, reaction buffer, deoxyribonucleoside triphosphate mixture with dUTP instead of dTTP, and 10 mM MgCl2), 3 mM MgCl2, and 1× LC PCR primer-probe set (Table 1) (Stx1a, Stx1b, Stx1f, Stx1r, Stx2a, Stx2b, Stx2f, and Stx2r, kit no. 315; TIB MolBiol LLC, Adelphia, NJ) was added to the LightCycler cuvette. Extracted DNA (5 μl) was added to the reaction mixture. The cycling program was as follows: template denaturing at 95°C for 10 min; amplification of the template for 45 cycles of 10 s at 95°C, 15 s at 55°C (single acquisition), and 15 s at 72°C; and detection of the amplified product by melting analysis for 0 s at 95°C, 20 s at 59°C, 20 s at 40°C, ramp of 0.2°C/s, 0 s at 85°C, ramp of 0.2°C (continuous acquisition), and 30 s at 40°C. stx1 was differentiated from stx2 amplification by melting curve analysis (Fig. 1). Positive and negative controls were included with each run. The assay was run successfully on two models of the LightCycler, 1.2 and 2.0.

Positive-control plasmids.

Two positive control plasmids were constructed using the pCR 2.1 TOPO TA cloning kit (Invitrogen Corp., Carlsbad, CA) according to the manufacturer's instructions. The sources of the stx1 and stx2 sequences were E. coli O157:H7 (ATCC 43890) and O157:H7 (ATCC 43889), respectively. The sequences were amplified using primers Stx1a and Stx1b to clone 208 bp of stx1 and Stx2a and Stx2b to clone 204 bp of stx2. The sizes of the cloned sequences were confirmed by agarose gel electrophoresis, and the plasmids were purified using the High Pure Plasmid Isolation Kit (Roche Applied Science, Indianapolis, IN). The control plasmids were diluted in Tris-EDTA buffer (pH 8.0) and stored at 4°C.

Stool processing for PCR.

A swab was used to transfer a pea-size amount of stool into 1 ml of sterile water. If the specimen was liquid enough to pipette, a 100- to 200-μl sample was mixed into 1 ml of sterile water. The stool-in-water samples were mixed by the use of a vortex apparatus and allowed to settle for at least 2 min. Then, 200 μl of the supernatant was transferred to a sample cartridge for DNA extraction using a MagNA Pure LC Total Nucleic Acid Isolation Kit on a MagNA Pure LC instrument (Roche Diagnostics).

Analytical sensitivity and specificity, and inhibition.

Stools sent to the clinical microbiology laboratory for Clostridium difficile testing were prepared as described above and used for the sensitivity and inhibition studies. For sensitivity studies, the stool-in-water samples were spiked with dilutions of E. coli O157:H7 before extraction. For inhibition studies, the stool-in-water sample was spiked with the plasmid control (final concentration, 100 copies/μl), and the mixture was extracted on the MagNA Pure LC instrument. To determine specificity, primer and probe sequences were used as subjects for a BLAST search on the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov ). In addition, a panel of nucleic acid extracts from organisms found in stool (Table 2) was evaluated with the PCR assay.

Verification of the PCR results.

A human subject protocol for clinical specimens included in this study was approved by the institutional review board prior to any testing. The PCR assay was compared to other methods using two sets of samples. The first was a prospective study including 204 consecutive stool specimens that were submitted to the clinical microbiology laboratory for Stx testing by the ProSpecT EIA (ProSpecT STEC; Remel, Lenexa, KS) with broth enrichment. In addition to the EIA, the specimens were cultured on Chromagar O157 (BD BBL, Sparks, MD). Isolates on Chromagar that were mauve were considered presumptive positive and were then confirmed on sorbitol MacConkey agar (BD BBL, Franklin Lakes, NJ). The EIA and culture plates were used in accordance with the manufacturers' instructions. The second set of stool samples included 85 archived clinical samples that had been frozen at −70°C. The set contained normal and diarrheal stools that were previously tested by routine stool culture (using sorbitol MacConkey agar) and/or tested for Stx by EIA (ProSpecT and/or Premier EHEC EIA [Meridian BioScience Cincinnati, OH]).
A positive PCR result was considered concordant with the comparison methods if a positive result was determined by either culture or EIA. Negative PCR results were considered concordant if all of the comparator methods used were negative. Samples with discordant results were retested by the same PCR assay, and nucleic acid extracts were sent to the Minnesota Department of Health (MDH) for analysis by a PCR method that used different primers (20).

RESULTS

The analytical sensitivity of the PCR assay was 100% at 2 copies/μl of extracted specimen or 10 copies/reaction. This is roughly equivalent to 104 CFU/g stool specimen. The inhibition studies demonstrated that none of the 53 specimen extracts tested contained substances that would cause a false-negative result in a low-positive sample. Melting curve analysis established that stx1 melts at 55.77°C ± 2°C, while stx2 melts at 66.91°C ± 2°C. Fifteen clinical samples yielded peaks between the two ranges. Six of these were sequenced, and all were found to be Stx sequences specific for stx1 or stx2. Therefore, a melting peak between 53.77 and 68.91 indicated a positive result for stx but did not allow differentiation of stx1 versus stx2.
The primers and probes were subjected to BLAST searches to identify potential cross-reacting sequences. Aside from the expected target, there were three organisms with exact matches to the Stx2a primer, Acinetobacter haemolyticus, Enterobacter cloacae, and Citrobacter freundii. At least three isolates of each of these species (strains acquired from ATCC or proficiency specimens from New York State or the College of American Pathologists) were tested in the cross-reactivity studies and were negative. Also, the BLAST search revealed no matches to the Stx2b primer, suggesting that no amplification would result in the event that Stx2a cross-reacted with an unintended sequence. In addition, 56 other organisms found in stool were tested in the assay, and none of them were positive (Table 2).
The accuracy experiments were divided into two parts. One was a series of 204 prospectively collected clinical stool specimens submitted for Stx testing by an EIA method, which we also cultured (Table 3). The other was a set of 85 archived stool specimens, some of which were previously positive for Stx (by EIA) and/or E. coli O157:H7 (by culture) and some of which were negative by toxin detection and culture. All of the prospective specimen results were concordant between PCR and EIA, including one positive specimen that was an O103 serotype STEC not detected by culture. Thirteen archived samples produced discordant results: six were previously positive by EIA, three were previously negative by EIA and culture, and four had previously discordant results of culture and EIA. Each of the discordant results was reextracted and retested by PCR. Each of the repeated results was the same as the initial result. To resolve the discordant results, the specimen extracts were sent to the MDH. The MDH tested the samples by traditional PCR, which used primers for stx1 and stx2 different from those in the real-time PCR. The results from the MDH experiments were all concordant with the real-time PCR results. Archived specimen data and combined data from prospective and archived specimens are displayed in Table 3. All initially discordant results were recalculated using the data from MDH and are displayed accordingly in Table 3. The sensitivity and specificity of the assay were both 100% compared to the combined standard.

DISCUSSION

We developed and validated a real-time PCR assay that detects STEC directly from stool with 100% sensitivity and specificity and same-day results, a significant improvement in turnaround versus culture or antigen assays. The PCR assay has the sensitivity to detect as few as 1,000 CFU in a small sample of stool. In addition, two levels of sequence selection impart the high specificity of the assay. The first level involves the primers binding to and amplifying the target sequence. The second level is binding of the hybridization probes to sequences internal to the primer binding sites. Although some of the melting temperatures of the positive samples were between the typical stx1 and stx2 ranges, 100% of the positive specimens were detected.
The PCR assay has the ability to differentiate stx1 and stx2; however, the significance of this determination has not been resolved. Although some studies have shown that stx2 tends to be associated with more serious disease (9, 10, 18), stx1 has also been associated with severe cases. Complicating matters further, some STEC isolates carry genes for both stx1 and stx2 or more than one type of stx2 (10). Notably, either type can cause serious disease, and the treatment for any STEC infection is primarily supportive—antibiotics should be withheld or discontinued (29, 31).
Interestingly, subtypes within the stx2 group carry different disease risks. The five main subtypes are stx2, stx2c, stx2d, stx2e, and stx2f (22, 26, 30). The BLAST searches revealed that the primer sequences for this assay matched stx2 and stx2c (GenBank accession no. Y10775 and M59432, respectively), which are the two types most commonly associated with the postinfection complication HUS, with 100% identity; the other subtypes have rarely or never been associated with HUS. The primer sequences also matched stx2d (GenBank accession no. L11078), found commonly in non-O157:H7 strains, with 100% identity; this subtype is associated with diarrhea but rarely with HUS (23). Subtypes stx2e and stx2f (GenBank accession no. X81416 and M29153, respectively) matched the primer sequences for the assay with less than 90% identity, but these two subtypes are present in seldom-encountered serogroups of E. coli that are not typically human pathogens (10, 11, 24).
The PCR assay has the ability to detect non-O157 STEC pathogens, as well as culture-negative stools. Although non-O157 STEC strains are thought to be infrequent in the United States, culture methods using sorbitol MacConkey agar alone may not detect them, so their prevalence may be underestimated (16). Some states have found that non-O157 serotypes cause a substantial portion of STEC cases (5, 12, 19), and many studies from Europe have revealed that O157 serotypes are often the minority of STEC strains detected in diarrheal stools (2, 14). Of the 204 prospective specimens included in this study, one of four positive results was due to a non-O157 serogroup, a rate of 25%. The isolate was an O103 serotype that fermented sorbitol and would have been missed if culture alone had been used. STEC was also detected by the PCR assay in five archived specimens that had been negative by culture (three of which were also negative by EIA). One limitation of the PCR method is that there is no isolate to characterize. Culture isolates are vital to public health efforts to detect outbreaks and track the epidemiology of STEC organisms.
One problem with Stx antigen assays is that a false positive may set off an inappropriate and potentially expensive investigation (4, 12). An additional benefit of the real-time PCR method described here is that the two sets of oligonucleotide primers and probes allow excellent selection of the desired target and minimize false-positive results. This was exemplified by the 100% specificity determined in this study. Another crucial aspect of the real-time platform is the ability to amplify and detect nucleic acid in a closed system, which minimizes the potential for contamination and false positives.
On the other hand, a false-negative result can be equally troubling, as a patient may receive antibiotic treatment, which could increase the risk of HUS. Some previous reports of PCR assays for Stx genes that use stool have demonstrated significant inhibition, and it was found necessary to use either a diluted extract or an enriched specimen (13). The assay described here found a 0% inhibition rate from stool, suggesting that false-negative results will be rare. Our laboratory has previously demonstrated 0% inhibition for 92 stools when they were prepared in the same manner for a C. difficile real-time PCR assay (27). In addition, the fact that the same extraction methodology preparatory to PCR can be used on whole blood without significant inhibition suggests that the presence of blood in stool will not impart a risk of false negativity (28).
Our assay is, to the best of our knowledge, the first comparison to culture and EIA of a LightCycler real-time PCR assay using a nonenriched stool specimen for STEC detection. Other groups have designed assays to detect STEC, either real-time PCR from isolated colonies or an enrichment broth or traditional PCR directly from a stool specimen, neither of which significantly improves turnaround time compared to culture or EIA. Schuurman et al. (25) described two real-time assays using stool specimens that were validated with a panel of STEC isolates, a group of 19 previously positive stools, and prospective specimens (3 of 115 stools were positive and confirmed by culture). Our assay compared favorably to the limit of detection but, in contrast, detected no PCR inhibition. We were able to include more than twice as many stool specimens, and our gold standard was a composite of both EIA and culture. Our assay will provide same-day turnaround with excellent sensitivity and specificity, which will provide the fastest possible result to the clinician.
FIG. 1.
FIG. 1. Melting curve analysis for the PCR assay. Amplification of stx1 generates a curve with a peak at 55.77°C ± 2°C, while stx2 generates a peak at 66.91°C ± 2°C. The lower intensity of the stx2 peak is consistent whether detected alone or with stx1.
TABLE 1.
TABLE 1. Primers and probes used in the PCR assaya
GeneNameSequence (5′ to 3′)
stx 1 bStx1a primerCAAGAGCGATGTTACGGT
 Stx1b primerAATTCTTCCTACACGAACAGA
 Stx1f probedCTGGGGAAGGTTGAGTAGCG
 Stx1r probeeCCTGCCTGACTATCATGGACA
stx 2 cStx2a primerGGGACCACATCGGTGT
 Stx2b primerCGGGCACTGATATATGTGTAA
 Stx2f probedCTGTGGATATACGAGGGCTTGATGTC
 Stx2r probeeATCAGGCGCGTTTTGACCATCT
a
Primer-Probe set, kit no. 315 (Tib MolBiol).
b
The stx1 target corresponds to positions 2996451 to 2996243 of GenBank accession no. NC_002655 (21).
c
The stx2 target corresponds to positions 1352455 to 1352659 of GenBank accession no. NC_002655 (21).
d
Labeled with fluorescein on the 3′ end.
e
Labeled with LC640 on the 5′ end and a phosphate on the 3′ end.
TABLE 2.
TABLE 2. Organisms tested with the stx PCR assay (n = 66)
OrganismAccession no. or sourcea
A. haemolyticusATCC 17906
A. haemolyticusATCC 17977
A. haemolyticusATCC 19194
Aeromonas hydrophilaCAP-D-1-82
Arcanobacterium pyogenesATCC 19411
Bacteroides distasonisATCC 8503
Bacteroides fragilisATCC 25285
Bacteroides thetaiotaomicronATCC 29741
Bacteroides vulgatusATCC 29327
Bifidobacterium adolescentisATCC 15703
Bifidobacterium bifidumATCC 29521
Bilophila wadsorthiaNYS-01-Ed
Campylobacter coliATCC 33559
Campylobacter jejuniATCC 33560
C. freundiiATCC 8090
C. freundiiNYS-2-01
C. freundiiNYS-2003-3 no. 5
C. difficileATCC 9689
Clostridium perfingensATCC 13124
Clostridium ramosumATCC 25582
Collinsella aerofaciensATCC 25986
Cryptosporidium sp.Isolate from cat
Dientamoeba fragilisATCC 30948
Eggerthella lentaATCC 25559
Encephalitozoon cuniculiATCC 50602
Encephalitozoon hellumATCC 50451
Encephalitozoon intestinalisATCC 50651
Entamoeba histolyticaATCC 30459
Entamoeba moshkovskiiATCC 30042
E. cloacaeATCC 13047
E. cloacaeCAP ID-13-B
E. cloacaeCAP-D-C-no.15
E. cloacaeCAP-D-3-84
Enterococcus faecalisATCC 19433-U
Enterococcus faeciumATCC 19434
E. coli O142:K86(B):H6ATCC 23985
E. coli O70:K:H42ATCC 23533
E. coliATCC 25922
Escherichia fergusoniiATCC 35469
Escherichia hermaniiATCC 33650
Escherichia vulnerisATCC 33821
Eubacterium rectaleATCC 33656
Fusobacterium nucleatumATCC 25559
Giardia lambliaATCC 30957
Klebsiella pneumoniaeATCC 700603
Lactobacillus delbrueckii subsp. lactiATCC 12315
Lactobacillus rhamnosusATCC 7469
Mycobacterium aviumATCC 700398
Peptostreptococcus magnusATCC 29328
Plesiomonas shigelloidesATCC 14029
Proteus mirabilisATCC 35659
Pseudomonas aeruginosaATCC 27853
Salmonella entericaATCC 35987
Salmonella group BCAP-D-1-69
Shigella boydiiATCC 29903
Shigella dysenteriaeATCC 25931
S. dysenteriaeCDC 82-002-72
Shigella flexneriCDC AB4-A04
S. flexneri serotype 2aATCC29903
Shigella sonneiATCC 25931
S. sonneiCDC 82-002-72
Staphylococcus aureusATCC 25923
Staphylococcus epidermidisATCC 14990
Streptococcus bovisCAP-D-16-83
Streptococcus sanguinisATCC 10556
Yersinia enterocoliticaATCC 9610
a
CAP, College of American Pathologists; NYS, New York State.
TABLE 3.
TABLE 3. Detection of stx by PCR in stool compared to a combined standarda
Real-time PCR resultNo. of prospective specimens No. of archived specimens Total no. of specimens 
 PositivebNegativecPositivedNegativeePositiveNegative
Positive40420460
Negative02000430243
a
Discordant results were resolved by a separate PCR method at the MDH. Results that were initially discordant with the real-time PCR results have been recalculated in this table to conform with the second PCR results from the MDH.
b
One positive by EIA only; three positive by both EIA and culture.
c
Negative by EIA and culture.
d
Positive by EIA and/or culture (n = 39). Three specimens were negative by EIA and/or culture but positive by the MDH PCR assay.
e
Negative by EIA and/or culture (n = 33). Specimens with discordant results were all negative by the MDH PCR assay (n = 10).

Acknowledgments

We thank Brian Duresko of the Mayo Clinic for help in gathering samples. We also appreciate the kind collaboration of the MDH, in particular, John Besser, Billie Anne Juni, Bonnie Koziol, Sharon Pendergrass, and Charlotte Taylor.

REFERENCES

1.
Bettelheim, K. A. 1998. Reliability of CHROMagar O157 for the detection of enterohaemorrhagic Escherichia coli (EHEC) O157 but not EHEC belonging to other serogroups. J. Appl. Microbiol.85:425-428.
2.
Bonnet, R., B. Souweine, G. Gauthier, C. Rich, V. Livrelli, J. Sirot, B. Joly, and C. Forestier. 1998. Non-O157:H7 Stx2-producing Escherichia coli strains associated with sporadic cases of hemolytic-uremic syndrome in adults. J. Clin. Microbiol.36:1777-1780.
3.
CDC. 2002. Multistate outbreak of Escherichia coli O157:H7 infections associated with eating ground beef—United States, June-July 2002. JAMA288:690-691.
4.
CDC. 2006. Importance of culture confirmation of Shiga toxin-producing Escherichia coli infection as illustrated by outbreaks of gastroenteritis—New York and North Carolina, 2005. MMWR Morb. Mortal. Wkly. Rep.55:1042-1045.
5.
CDC. 2007. Laboratory-confirmed non-O157 Shiga toxin-producing Escherichia coli—Connecticut, 2000-2005. MMWR Morb. Mortal. Wkly. Rep.56:29-31.
6.
CDC. 2006. Ongoing multistate outbreak of Escherichia coli serotype O157:H7 infections associated with consumption of fresh spinach—United States, September 2006. MMWR Morb. Mortal. Wkly. Rep.55:1045-1046.
7.
CDC. 1993. Update: multistate outbreak of Escherichia coli O157:H7 infections from hamburgers—western United States, 1992-1993. MMWR Morb. Mortal. Wkly. Rep.42:258-263.
8.
Cleary, T. G. 2004. The role of Shiga-toxin-producing Escherichia coli in hemorrhagic colitis and hemolytic uremic syndrome. Semin. Pediatr. Infect. Dis.15:260-265.
9.
Cornu, G., W. Proesmans, A. Dediste, F. Jacobs, J. Van De Walle, A. Mertens, J. Ramet, and S. Lauwers. 1999. Hemolytic uremic syndrome in Belgium: incidence and association with verocytotoxin-producing Escherichia coli infection. Clin. Microbiol. Infect.5:16-22.
10.
Eklund, M., K. Leino, and A. Siitonen. 2002. Clinical Escherichia coli strains carrying stx genes: stx variants and stx-positive virulence profiles. J. Clin. Microbiol.40:4585-4593.
11.
Friedrich, A. W., M. Bielaszewska, W. L. Zhang, M. Pulz, T. Kuczius, A. Ammon, and H. Karch. 2002. Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J. Infect. Dis.185:74-84.
12.
Gavin, P. J., L. R. Peterson, A. C. Pasquariello, J. Blackburn, M. G. Hamming, K. J. Kuo, and R. B. Thomson, Jr. 2004. Evaluation of performance and potential clinical impact of ProSpecT Shiga toxin Escherichia coli microplate assay for detection of Shiga toxin-producing E. coli in stool samples. J. Clin. Microbiol.42:1652-1656.
13.
Holland, J. L., L. Louie, A. E. Simor, and M. Louie. 2000. PCR detection of Escherichia coli O157:H7 directly from stools: evaluation of commercial extraction methods for purifying fecal DNA. J. Clin. Microbiol.38:4108-4113.
14.
Johnson, K. E., C. M. Thorpe, and C. L. Sears. 2006. The emerging clinical importance of non-O157 Shiga toxin-producing Escherichia coli. Clin. Infect. Dis.43:1587-1595.
15.
Karch, H., P. I. Tarr, and M. Bielaszewska. 2005. Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol.295:405-418.
16.
Kehl, S. C. 2002. Role of the laboratory in the diagnosis of enterohemorrhagic Escherichia coli infections. J. Clin. Microbiol.40:2711-2715.
17.
Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev.11:142-201.
18.
Ostroff, S. M., P. I. Tarr, M. A. Neill, J. H. Lewis, N. Hargrett-Bean, and J. M. Kobayashi. 1989. Toxin genotypes and plasmid profiles as determinants of systemic sequelae in Escherichia coli O157:H7 infections. J. Infect. Dis.160:994-998.
19.
Park, C. H., H. J. Kim, and D. L. Hixon. 2002. Importance of testing stool specimens for Shiga toxins. J. Clin. Microbiol.40:3542-3543.
20.
Paton, A. W., and J. C. Paton. 1998. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol.36:598-602.
21.
Perna, N. T., G. Plunkett III, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature409:529-533.
22.
Persson, S., K. E. Olsen, S. Ethelberg, and F. Scheutz. 2007. Subtyping method for Escherichia coli Shiga toxin (verocytotoxin) 2 variants and correlations to clinical manifestations. J. Clin. Microbiol.45:2020-2024.
23.
Pierard, D., G. Muyldermans, L. Moriau, D. Stevens, and S. Lauwers. 1998. Identification of new verocytotoxin type 2 variant B-subunit genes in human and animal Escherichia coli isolates. J. Clin. Microbiol.36:3317-3322.
24.
Schmidt, H., J. Scheef, S. Morabito, A. Caprioli, L. H. Wieler, and H. Karch. 2000. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl. Environ. Microbiol.66:1205-1208.
25.
Schuurman, T., A. Roovers, W. K. van der Zwaluw, A. A. van Zwet, L. J. Sabbe, A. M. Kooistra-Smid, and Y. T. van Duynhoven. 2007. Evaluation of 5′-nuclease and hybridization probe assays for the detection of Shiga toxin-producing Escherichia coli in human stools. J. Microbiol. Methods70:406-415.
26.
Serna, A. T., and E. C. Boedeker. 2008. Pathogenesis and treatment of Shiga toxin-producing Escherichia coli infections. Curr. Opin. Gastroenterol.24:38-47.
27.
Sloan, L. M., B. J. Duresko, D. R. Gustafson, and J. E. Rosenblatt. 2008. Comparison of real-time PCR for detection of the tcdC gene with four toxin immunoassays and culture in diagnosis of Clostridium difficile infection. J. Clin. Microbiol.46:1996-2001.
28.
Smith, T. F., M. J. Espy, J. Mandrekar, M. F. Jones, F. R. Cockerill, and R. Patel. 2007. Quantitative real-time polymerase chain reaction for evaluating DNAemia due to cytomegalovirus, Epstein-Barr virus, and BK virus in solid-organ transplant recipients. Clin. Infect. Dis.45:1056-1061.
29.
Tarr, P. I., C. A. Gordon, and W. L. Chandler. 2005. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet365:1073-1086.
30.
Tzipori, S., A. Sheoran, D. Akiyoshi, A. Donohue-Rolfe, and H. Trachtman. 2004. Antibody therapy in the management of Shiga toxin-induced hemolytic uremic syndrome. Clin. Microbiol. Rev.17:926-941.
31.
Wong, C. S., S. Jelacic, R. L. Habeeb, S. L. Watkins, and P. I. Tarr. 2000. The risk of the hemolytic-uremic syndrome after antibiotic treatment of Escherichia coli O157:H7 infections. N. Engl. J. Med.342:1930-1936.
American Society for Microbiology ("ASM") is committed to maintaining your confidence and trust with respect to the information we collect from you on websites owned and operated by ASM ("ASM Web Sites") and other sources. This Privacy Policy sets forth the information we collect about you, how we use this information and the choices you have about how we use such information.
FIND OUT MORE about the privacy policy